Abstract
The activity and the metabolism of the brain change rhythmically during the day/night cycle. Such rhythmicity is also observed in cultured neurons from the suprachiasmatic nucleus, which is a critical center in rhythm maintenance. However, this issue has not been extensively studied in cultures from areas less involved in timekeeping, as the hippocampus. Using neurons cultured from the hippocampi of newborn rats (both male and female), we observed significant time-dependent changes in global activity, in synaptic vesicle dynamics, in synapse size, and in synaptic mRNA amounts. A transcriptome analysis of the neurons, performed at different times over 24 h, revealed significant changes only for RNA-binding motif 3 (Rbm3). RBM3 amounts changed, especially in synapses. RBM3 knockdown altered synaptic vesicle dynamics and changed the neuronal activity patterns. This procedure also altered local translation in synapses, albeit it left the global cellular translation unaffected. We conclude that hippocampal cultured neurons can exhibit strong changes in their activity levels over 24 h, in an RBM3-dependent fashion.
SIGNIFICANCE STATEMENT This work is important in several ways. First, the discovery of relatively regular activity patterns in hippocampal cultures implies that future studies using this common model will need to take the time parameter into account, to avoid misinterpretation. Second, our work links these changes in activity strongly to RBM3, in a fashion that is independent of the canonical clock mechanisms, which is a very surprising observation. Third, we describe here probably the first molecule (RBM3) whose manipulation affects translation specifically in synapses, and not at the whole-cell level. This is a key finding for the rapidly growing field of local synaptic translation.
Introduction
Maintaining a synchronous pattern of day and night activity is critical for the function of all of the tissues of a mammalian organism. This is ensured by several well-established mechanisms, the first of which is the rhythmic expression of molecular clock genes in every cell throughout the day/night (Partch et al., 2014). These genes control the timing of many biological functions, such as glucose metabolism and electrical activity (Dibner et al., 2010). A second fundamental mechanism is provided by the function of the suprachiasmatic nucleus (SCN), a central pacemaker of the hypothalamus, which is in charge of the molecular clock synchronization among the cells of the animal (Welsh et al., 2010). The SCN achieves this by encoding time information in its spontaneous firing rate (low during the night, and high during the day) (Colwell, 2011), and by communicating this to other brain regions and tissues through synaptic projections and hormones (Buijs et al., 2006).
The rhythmic expression of clock genes in the SCN controls the expression and function of ion channels as the BK channels (large-conductance calcium-activated potassium channels) or L-type voltage-gated calcium channels (Colwell, 2011). The function of these proteins induces oscillations in the resting membrane potential (Pennartz et al., 2002; Kononenko et al., 2008), thereby changing the firing rates, which in turn ensures the rhythmic firing activity of the SCN, which has been demonstrated even in dispersed cultures (Green and Gillette, 1982; Herzog et al., 1998). The rhythmic firing is resistant to disturbances in the light-dark cycle (Kuhlman and McMahon, 2004; Nakamura et al., 2011), and it persists in SCN cultures that are not subjected to day/night light or temperature changes. However, clock gene expression alone is not sufficient to maintain the synchronized firing of SCN neurons in the long-term. In culture, they slowly become desynchronized, with every cell eventually assuming its own individual firing pattern that oscillates throughout the day and night cycle (Welsh et al., 1995). The desynchronization is accelerated by blocking network activity, suggesting that neuronal communication is important in maintaining the rhythm synchronicity for long time intervals (Honma et al., 2000; Yamaguchi et al., 2003).
The observation of rhythmic activity in dispersed SCN cultures prompted research also in other cell types. Fibroblast cell lines were found to exhibit molecular clock rhythmicity, albeit they lose cell synchronicity rapidly (Nagoshi et al., 2004), unless they are resynchronized by regular changes in temperature (Brown et al., 2002) or culture media (Balsalobre et al., 1998). However, many brain areas have been little investigated in relation to rhythmic activity (Paul et al., 2020). A prominent example is the hippocampus, which is involved in learning and memory, two processes that are strongly regulated by the circadian clock (Gerstner and Yin, 2010). Hippocampal activity in vivo oscillates throughout the day and night cycle (Munn and Bilkey, 2012), and its ability to respond to plasticity-inducing stimuli is also dependent on the time of day/night (Harris and Teyler, 1983). This demonstrates that the hippocampus function is governed by the 24 h cycle but leaves open the question of whether this is exclusively because of the general rhythmicity induced by the SCN, or whether this is a fundamental hallmark of the hippocampal neuron, which would persist in dissociated cultures.
To solve this question, we turned to the rat hippocampal culture. Surprisingly, we found that the culture activity exhibited significant oscillations throughout 24 h, which were accompanied by substantial changes in presynaptic activity and synapse size. In addition, we found that the abundance of RNA-binding motif 3 (RBM3), a cold-shock protein (Danno et al., 1997, 2000) that is known to promote translation (Dresios et al., 2005), also oscillates throughout 24 h, especially in synapses. Its knockdown changed the activity pattern of the neurons, as well as synapse activity and size, possibly through effects on local translation. Overall, these data suggest that hippocampal cultures exhibit endogenous changes in activity levels across 24 h, and that these patterns are under the control of RBM3.
Materials and Methods
Hippocampal cultures
Primary disassociated hippocampal cultures were prepared from newborn rats (Banker and Cowan, 1977). The hippocampi were dissected from rat brains, using animals of both sexes, with a general female to male ratio of 1:1. They were washed with Hanks balanced salt solution (Thermo Fisher Scientific). Later on, hippocampi were kept in the enzyme solution (1.6 mm cysteine, 100 mm CaCl2, 50 mm EDTA, and 25 units papain in 10 ml DMEM) for 1 h. To inactivate the enzyme solution, 5 ml DMEM (Thermo Fisher Scientific) that contains 10% FCS, 0.5% albumin, and 0.5% trypsin inhibitor was added and incubated for 15 min. Cells were further separated by mechanical disruption and were seeded on poly L-lysine (Sigma Millipore) coated circular coverslips (1.8 cm in diameter) with a density of 80,000 cells per coverslip. The neurons were kept in plating medium (3.3 mm glucose, 2 mm glutamine, and 10% horse serum in DMEM) for 1-2 h at 37°C. Afterward, the medium was exchanged to Neurobasal-A medium (with B27 supplement, 1% GlutaMax, and 0.2% penicillin/streptomycin mixture). The cultures were maintained at 37°C and 5% CO2 for ∼20 d.
Calcium imaging
Neurons were transduced with 3 µl of NeuroBurst Orange Lentivirus (Sartorius) at DIV10, and kept in the incubator for 9 additional days. For imaging, the coverslips were placed into imaging chamber and imaged with and inverted Nikon Ti eclipse epifluorescence microscope equipped with a 20× Plan Apo (Nikon) objective, an HBO-100W lamp, an IXON X3897 Andor camera, and a cage-incubator (Okolab). The temperature was set at 37°C and the atmosphere with 5% CO2 throughout the imaging session. For long-term recordings, neurons were plated in a glass-bottom 24-well plate (Cellvis) and imaged directly from the plate.
Promoter reporter imaging
The plasmid for the promoter reporter imaging was synthesized by GenScript, using pUC57 as a backbone. The promoter was selected as the sequence from 500 nucleotides in the upstream until 50 nucleotides in the downstream of the BMAL1 gene from Rattus novergicus. The plasmid expressed EGFP under the control of this promoter. The EGFP was destabilized by adding to its C terminus the residues 422-461 of mouse ornithine decarboxylase, which provides a 2 h half-life time for the molecule (Li et al., 1998). Neurons were transfected with Lipofectamine 2000 (Thermo Fisher Scientific) at DIV5, according to the manufacturer's instructions.
Immunostaining
Neurons were washed with the Tyrode's buffer (124 mm NaCl, 5 mm KCl, 2 mm CaCl2, 1 mm MgCl2, 30 mm D-glucose, and 25 mm HEPES) and then fixed with 4% PFA (Sigma Millipore) for 30 min at room temperature. Later on, cells were incubated in the quenching solution (100 mm NH4Cl in PBS) for 30 min at room temperature. Subsequently, neurons were washed with permeabilization solution (3% BSA, 0.01% Triton-X-100 in PBS) 3 times for 5 min on a shaker. Permeabilized neurons were incubated for 1 h, with 0.2% of the primary antibody in the permeabilization solution. Then, they were washed again with permeabilization solution 3 times for 5 min on a shaker. Neurons were incubated for 1 h with 0.5% of the secondary antibody in permeabilization solution. Later on, they were washed with high-salt PBS (supplemented with 0.38 m NaCl) solution 3 times for 5 min on a shaker and 2 times for 5 min with PBS. Last, coverslips were mounted in 8 µl Mowiol (Merck Millipore) and stored at 4°C. Unless otherwise specified, imaging was performed with IX83 inverted Olympus confocal microscope (Abberior) that is equipped with a 100× super-apochromat and coverslip-corrected oil objective (Olympus). The analysis was performed on MATLAB (The MathWorks) and plotted with GraphPad. The Syph (101004) and Homer1 (160011) antibodies were purchased from Synaptic Systems, and the RBM3 antibody (ab134946) was purchased from Abcam.
Synaptotagmin1 uptake assay
In order to study the synaptic vesicle usage, we took advantage of live staining with an antibody targeting the luminal domain of Synaptotagmin1. At DIV21, coverslips with neurons were placed in a new 12-well plate (Greiner Bio-One) with 300 μl of their own Neurobasal-A medium. Neurons were incubated with 2.5 μg/ml Syt1-Atto647N antibody (105311AT1, Synaptic Systems) for 45 min. Afterward, 16.7 nm anti-mouse secondary nanobody (N2002-At542-S, Nanotag) conjugated to Atto542 was added into the medium and incubated for15 min. Next, the neurons were washed with ice-cold Tyrode's buffer and fixed with 4% PFA. The immunostaining procedure for synaptophysin is described in Immunostaining. In order to see the spontaneous synaptic vesicle fusion, the action potential generation was blocked by adding 5 μm TTX (Tocris Bioscience). In time-series experiments, the uptake assay was performed at different time points of the day and night. For the knocked down conditions, the uptake assay did not have secondary nanobody incubation. Instead, Syt1-Atto647N antibody was incubated for either 15 min or 1 h. An inverted Nikon Ti eclipse epifluorescence microscope (Nikon), which has a 20× Plan Apo (Nikon) objective, an HBO-100W lamp, and an IXON X3897 Andor camera, was used for imaging, and the images were analyzed using MATLAB (The MathWorks).
Puromycin assay
Puromycin (ant-pr-1, InvivoGen) is an antibiotic that interferes with mammalian translation and incorporates itself into the polypeptide chain. Coverslips were placed in a new 12-well plate with 300 μl of their own Neurobasal-A medium and were incubated with 1 μl of 0.3 mg/ml puromycin for 10 min in the incubator. Later on, they were washed twice with ice-cold Tyrode's buffer and fixed with 4% PFA. As a control, another antibiotic called anisomycin was used. It halts the translation complex and does not allow puromycin to reach the binding site in the ribosome. Control groups were incubated with 0.13 μm anisomycin (A5862, Sigma Millipore) 10 min before puromycin treatment. Later, the immunostainings against synaptophysin, Homer1, and puromycin (MABE343, Merck Millipore) were performed as described in Immunostaining. Puromycin, anisomycin, and puromycin antibody were generous gifts from Prof. Peter Rehling (University Medical Center Göttingen, Göttingen, Germany).
Poly(A) staining
Oligo(dT) and oligo(dA) stainings were done as described previously (Chou et al., 2018). Briefly, neurons were fixed and quenched, as stated in Immunostaining. They were fixed one more time with ice-cold absolute methanol for 10 min. Cells were rehydrated first with 70% EtOH and then with 1 m Tris buffer, pH 8, for 10 min. Later on, neurons were washed with hybridization buffer [1 mg/ml yeast tRNA, 0.005% BSA, 10% dextran sulfate, 25% formamide in finalized 2× SSC (0.3 m NaCl, 30 mm trisodium citrate in water)] once and then incubated with 1:1000 of 1 µg/µl 30 nucleotide long either oligo(dT) or oligo(dA) conjugated to Atto647N (Sigma Millipore) for 1 h in hybridization buffer at 37°C. Samples were washed 2 times with 4× SSC and 2 times 2× SSC. The following immunostainings against synaptophysin and Homer1 were performed as specified in Immunostaining.
Transcriptomics
The mRNAseq experiments as well as the analysis were performed by Transcriptome and Genome Analysis Laboratory. Samples were sequenced with HiSeq-4000 (Illumina) with 50 bp single-end design. The alignment was performed with STAR 2.5.2a (Dobin et al., 2013), and the assignment of reads to genes was done by using featureCounts 1.5.0 (Liao et al., 2019) with R. norvegicus genome assembly rn6 and gene version 91. After the count calculation of each transcript, we used the limma package to find differentially expressed transcripts (Ritchie et al., 2015). GO analysis was performed on the Webgestalt database with Ensembl gene IDs and difference folds between time points (Wang et al., 2017). The result of gene set enrichment analysis reports the pathways with p < 0.05 and false discovery rate < 0.05 (Table 1).
short-hairpin RNA (shRNA) virus preparation
The sequence for shRNA was prepared with the help of the BLOCK-iT RNAi Designer database (Thermo Fisher Scientific). The shRNA sequence was synthesized by Genscript and placed in the pAAV-U6sgRNA (60958, Addgene) (Swiech et al., 2015). The plasmid of scrambled (Scr) shRNA was a generous gift of the Fornasiero laboratory (Keihani et al., 2019). Adeno-associated virus was produced in human embryonic kidney 293T (DSMZ) with three plasmids that have packaging proteins of recombinant adeno-associated virus, and were described previously (McClure et al., 2011). Human embryonic kidney cells were transfected with Lipofectamine 2000 (Thermo Fisher Scientific) using the manufacturer's instructions. Three days later, transfected cells were harvested and centrifuged. The pellet was resuspended in 1 ml Tyrode's buffer and was exposed to freeze/thaw cycles 3 times in 70% EtOH and dry ice mixture for lysis. After the addition of 1 µl of Nuclease (Thermo Fisher Scientific), the lysate was incubated at 37°C for 30 min and was centrifuged with 1000 × g for 5 min. The supernatant was aliquoted and stored at the −80°C freezer. The virus titration was performed by observing the GFP signal from serial dilution on transfected hippocampal cultures. The virus was used on the primary hippocampal culture at DIV15. The RBM3 shRNA sequence is as follows: CACCGCGTCTTCCCGCGCCGCAGTCCGAAGACTGCGGCGCGGGAAGACGCTTTTTTTT. The BMAL1 shRNA sequence is as follows: CACCGCAAACTACAAGCCAACATTTCGAAAAATGTTGGCTTGTAGTTTGCTTTTTTTT.
Experimental design and statistical tests
To find correlations between two groups, Pearson's correlation was used (see Figs. 1E, 2B, 6F). For long-term calcium imaging where individual neurons were traced, the Friedman test followed by Dunn's multiple comparisons test was used (see Fig. 1D–G). To determine the significant changes in time-series nonparametric data, the Kruskal–Wallis test followed by Dunn's multiple comparisons test was used (see Figs. 4B, 5E, 8B,D, 9H,I, 10J). For parametric time-series data, the one-way ANOVA test followed by Dunnett's multiple comparisons test was used (see Figs. 3D,G,E,H,J,K, 9G, 10H,I). For analysis between groups, we used Mann–Whitney test (see Figs. 6B, 7B,D,F,H,J,K, 10A-G). For multiple comparisons, we used two-way ANOVA test followed by Tukey's multiple comparisons test (see Fig. 3C,F). Tests were performed by GraphPad Prism software version 8.3.0 (GraphPad Software).
Results
Neuronal activity changes throughout 24 h in dissociated hippocampal cultures
Primary hippocampal cultures are widely used, as they are relatively simple to prepare and maintain most of the important functional features of the in vivo neurons (Dotti et al., 1988). We used them here, relying on a classical protocol (Banker and Cowan, 1977) that dissociates the hippocampi of newborn rats and results in mixed glia and neuron cultures. Most of the neurons are glutamatergic (>90%) (Benson et al., 1994) and have a mature morphology and synapse development already at ∼12 DIV.
To determine whether primary hippocampal cultures show differences in their electrical activity in dependence on the time of day/night, we performed long-term calcium imaging, using a genetically encoded calcium indicator, NeuroBurst (Sartorius). To sample culture activity regularly, we imaged the neurons (starting at DIV18) every 4 h, for 45 s (Fig. 1A). This enabled us to obtain a fluorescence-based measure of the activity of the individual neurons at the particular time points (Fig. 1B), which we termed “activity score.” Individual neurons exhibited changes in the activity score throughout the day and night, with the examples shown in Figure 1B having strong peaks at 6:00 and 14:00. Such changes in activity were observed for all neurons investigated (see a selection in Fig. 1C).
To test whether the activity of the different neurons was synchronized, we performed this experiment with four different culture preparations, in which we tracked 156 different neurons. Their average activity score showed significant changes throughout the measurement (Fig. 1D), with activity being high at 14:00, dropping until ∼22:00, and rising again after 02:00, before dropping again for several hours, and finally rising one more time before the end of our measurements. Randomizing the timing of the individual neuronal measurements eliminates all significant changes (Fig. 1G,H), which suggests that the results obtained here are unlikely to be because of chance, but are rather because of synchronous culture activity. The pattern observed does not conform to a precise 24 h pattern (Fig. 1D). Two possible interpretations could be made. First, the cultures exhibit their own pattern of activity, which does not relate to a 24 h rhythm. Second, the activity of the individual neurons does conform to a 24 h rhythm, but they are partially desynchronized, so that a 24 h rhythm is no longer observed at the whole culture level, especially when averaging results across different cultures, as in Figure 1D. The second interpretation appeared probable, since 24 h patterns are difficult to maintain with precision even in SCN cultures (Honma et al., 1998). Interestingly, the first 32 h of the recordings overlapped well with the next 32 h (Fig. 1E). Similar observations were made for younger cultures (DIV10; Fig. 1F). Again, the pattern did not seem to conform to a simple 24 h cycle.
To test this in more detail, we analyzed whether the activity patterns of individual neurons correlated significantly to the 24 h pattern of a bona fide molecular clock gene. We expressed in our cultures a destabilized GFP molecule, relying on the promoter of the clock gene BMAL1. The fluctuations in the GFP amounts, which report the BMAL1 promoter activity, conformed to a 24 h cycle, with peaks at night and lower values during the day (Fig. 2). In parallel, we analyzed the activity patterns of the GFP-expressing neurons (Fig. 2). We found that their activity patterns correlated significantly (albeit negatively) to the BMAL1 promoter activity. This implies that the activity of individual neurons in these cultures can be seen as exhibiting a 24 h rhythm, albeit this is difficult to observe when averaging many neurons and independent cultures, because of a partial desynchronization.
The dynamics of the synaptic vesicles also change throughout 24 h
Oscillations in neuronal activity should also be reflected at the synaptic level, especially in the synaptic vesicle dynamics. The vesicle behavior can be analyzed with precision by using antibodies that detect the luminal (intravesicular) domain of the vesicular calcium sensor synaptotagmin 1 (Syt1) (Matteoli et al., 1992; Kraszewski et al., 1995). The antibodies are taken up by synaptic vesicles during their recycling, since they expose the luminal epitopes during exocytosis, and thus enable the antibody to penetrate into the vesicles, and to be endocytosed (Fig. 3A). We incubated the cultures every 6 h with fluorescently conjugated Syt1 antibodies for 45 min. This time interval is sufficient to label (saturate) all active synaptic vesicles, and therefore to provide a measure of the active vesicle pool size (Truckenbrodt et al., 2018). We then applied to the cultures fluorescently conjugated nanobodies that recognize the Syt1 antibodies, for 15 min. The nanobodies bind Syt1 antibodies that are exposed to the surface during vesicle activity (Fig. 3A). This short incubation interval does not saturate all binding sites (Truckenbrodt et al., 2018), and therefore provides a measure of synaptic activity at the respective time point, rather than a measure of the vesicle pool size. To confirm the validity of this assay, we compared normal neurons with neurons in which network activity was blocked using the Na+ channel inhibitor TTX. TTX blocked active vesicle recycling, and therefore reduced both the antibody and nanobody stainings (Fig. 3B,C,F), as expected.
These measurements suggested that the size of the actively recycling vesicle pool is relatively constant throughout 24 h (Fig. 3D), but the synaptic activity, as measured by the nanobody intensity, exhibits significant differences (Fig. 3G). None of these measurements showed any changes in cultures maintained constantly in TTX, as expected (Fig. 3E,H).
Overall, these experiments confirm the idea that, at the synapse level, neurons show changes in their activity patterns throughout 24 h. As these measurements only targeted the active vesicles, which make up only ∼50% of all vesicles (Rizzoli and Betz, 2005), we sought to also obtain a measurement of the entire vesicle pool, by immunostaining the synapses at different time points, relying on the vesicle marker synaptophysin (Takamori et al., 2006). This again showed changes during 24 h, with a substantial increase at 02:00 (Fig. 3I,K). We observed similar behavior for a marker of the postsynaptic density, Homer1 (Fig. 3K). No changes could be detected in the number of synapses (Fig. 3J). These results suggest that not only neuronal and synapse activity, but also synapse size, depends on the time of day/night.
Synaptic mRNA amounts are subject to change over 24 h
Along with brain activity, brain metabolism also changes throughout the day and night cycle, including aspects as transcription and translation, which have been shown to exhibit strong circadian rhythmicity (Noya et al., 2019). We therefore proceeded to test whether such changes could also be observed in cultured hippocampal neurons. We analyzed the mRNA levels in the cultures, relying on FISH, performed with fluorescently conjugated oligonucleotides containing multiple thymidine (dT) moieties. These label specifically the polyadenylated tails of mRNAs, and showed measurable signals throughout the cells, including synaptic areas (Fig. 4A). We analyzed the FISH signals and found that they changed throughout the 24 h (Fig. 4B). Nevertheless, these results demonstrate that dynamic changes of the mRNA levels take place over time in disassociated hippocampal cultures.
The abundance of RBM3 changes over 24 h, especially at synapses
To determine the molecular mechanisms responsible for the changes in neuronal activity, synapse morphology, and mRNA amounts throughout 24 h, we analyzed the transcriptome of the cultures at different times of day/night, using mRNA sequencing (mRNAseq) (Fig. 5A, N = 6 independent experiments). Although several overall changes could be seen among the different sets of genes, relating to processes, such as synaptic transmission and neuronal morphogenesis (Table 1), only one transcript showed a significant differential expression when the results from six different culture preparations were combined (Fig. 5B): RNA-binding motif 3 (Rbm3). This molecule showed the same general pattern of expression as bona fide clock genes, such as like Bmal1 and Per2 (Fig. 5C), but its variation among different cultures was small enough to result in significant differences between the time points, unlike Bmal1 or Per2. We assume that the desynchronization between different cell cultures is strong enough to mask the rhythmicity of Bmal1 or Per2, albeit at least the former is clearly exhibiting changes over 24 h in the cultured neurons (Fig. 2).
Before pursuing this idea, we confirmed that its abundance is indeed cyclic in neurons. RBM3 immunostainings revealed that the protein has profound oscillations throughout 24 h, with minima in the evening and maxima around 08:00 (Fig. 5D,E). These changes were far more profound in synapses than in other compartments (Fig. 5E), which again suggests that this molecule may be involved in synaptic function.
RBM3 is a cold-shock protein that is involved in translation, and has been published as a potential biomarker for breast and colon cancer because of this role (Sureban et al., 2008). However, RBM3 has also been connected to brain function, since it was discovered that it protects synapses from hypothermia (Peretti et al., 2015). More interestingly, it controls the alternative polyadenylation of core clock genes, which explains its connection to the circadian clock (Liu et al., 2013). A systematic transcriptomics analysis of the molecular circadian rhythm indicates that Rbm3 is a rhythmically expressed transcript in the SCN tissue (Yan et al., 2008). To confirm this, we also surveyed circadian transcriptomics datasets that are available online at the Gene Expression Omnibus repository (Fig. 5F,G). We found that RBM3 has a rhythmic expression in the SCN (GSE70391). Moreover, Rbm3 exhibits rhythmic expression throughout the day and night cycle in the hippocampus tissue in vivo (GSE66875) (Renaud et al., 2015). RBM3 appeared therefore as a strong candidate molecule, which may be involved in organizing daily (24 h) patterns of neuronal activity.
RBM3 controls the firing pattern in primary hippocampal cultures
To determine whether RBM3 affects neuronal activity, we resorted to long-term calcium imaging (as in Fig. 1), in cultures subjected to RBM3 knockdown, or to the transfection of a scrambled oligonucleotide control. The RBM3 knockdown reduced the amounts of the protein significantly (Fig. 6A,B), albeit not completely. When analyzing in parallel the calcium signals from the knockdown cultures and their controls, it became obvious that activity could still be detected in both conditions (Fig. 6C,D), but that the patterns were different. The RBM3 knockdowns had peaks of activity at precisely the time points when the control cultures had their minimal activity (Fig. 6E,F). This relation was significant (Fig. 6F), implying that RBM3 has an important role in regulating the pattern of neuronal activity.
To test whether these effects also translated to synaptic vesicle activity, we relied on the Syt1 uptake assay used in Figure 3. We chose the time point that exhibited the highest difference in activity in calcium imaging (18:00; Fig. 6), and incubated the cultures with Syt1 antibodies for 15 min, to determine the activity levels (Fig. 7A–D), or for 60 min, in different coverslips, to measure the total size of the actively recycling vesicle pool (Fig. 7E–H). As cultures undergoing the knockdown treatment may be more fragile than unmodified cultures, we avoided the assay relying on mixtures of nanobodies and antibodies (from Fig. 3A), which involves multiple buffer changes that may harm the cultures, and we simply relied on separate 15 or 60 min incubations. Both measurements showed significant differences, with RBM3 knockdown enhancing synaptic function (Fig. 7B,F), in agreement with the change in activity observed at 18:00 in calcium imaging (Fig. 6). Performing these measurements in the presence of TTX, which blocks network activity, resulted in no significant differences between the knockdowns and the controls (Fig. 7D,H).
Finally, immunostainings for synaptophysin or Homer1, performed to determine the synapse size (as in Fig. 3I–K), suggested that RBM3 knockdown significantly influences the postsynapse size (Fig. 7I–K). Overall, these results demonstrate that RBM3 is strongly involved in the changes of synaptic and neuronal function throughout 24 h.
RBM3 controls local translation at the postsynapse
As mRNA amounts varied throughout 24 h (Fig. 4), and as RBM3 is an mRNA binding protein, we next sought to determine whether the RBM3 knockdown influences the mRNA levels in synapses, where the highest RBM3 oscillations were observed (Fig. 5). We repeated the FISH experiments performed in Figure 4, either in RBM3 knockdown neurons or in controls (Fig. 8). No significant changes could be observed: neither when relying on synaptophysin as a synaptic marker (Fig. 8A,B), nor when relying on the postsynaptic marker Homer1 (Fig. 8C,D). This suggests that RBM3 does not influence the synaptic mRNA levels, at least not sufficiently for detection with this FISH assay.
As RBM3 has been strongly linked to translation (Dresios et al., 2005; Smart et al., 2007), we next analyzed its potential influence on this process. We relied on an assay that reports the translation sites, the so-called puromycin assay (Hafner et al., 2019). Puromycin is an antibiotic that binds to the P site of the ribosome and incorporates itself into the polypeptide chain. This results in the polypeptide chain being released from the ribosome prematurely (Fig. 9A), thereby stopping the translation process. A subsequent immunostaining with a specific puromycin antibody reports all of the stopped translation sites, thereby providing an accurate estimate of ongoing translation in the particular cellular area. We combined this assay with the RBM3 knockdown (Fig. 9B) and found that this treatment significantly reduced local translation in postsynapses (Fig. 9G). The translation levels remaining in RBM3 knockdowns were close to the background levels, measured by pretreating the cultures with anisomycin, an antibiotic that halts the ribosomal complex and prevents the incorporation of puromycin (Fig. 9D,E,G). A similar trend was also observed in presynapses (Fig. 9C,F), albeit the local translation levels were too low for a clear differentiation between RBM3 knockdowns and controls (Fig. 9H). Importantly, when we analyzed the effects of the knockdown at the level of the whole cells, no significant difference could be measured (Fig. 9I). This suggests that RBM3 controls local translation in postsynapses, and possibly also in presynapses, but its effects do not extend, under these conditions, to the organization of translation in the entire cell.
Importantly, to study the influence of molecular clock on the primary hippocampal culture, we repeated several of the assays presented above with a knockdown for a core clock gene, Brain, and muscle ARNT like 1 (BMAL1). The significant reduction in BMAL1 gene expression on BMAL1 shRNA was verified using qPCR. Surprisingly, we have not observed any substantial changes in the BMAL1 knocked down neurons (Fig. 10). This confirms that the observations we made above are specific for RBM3, which again underlines the importance of this protein for neuronal activity in these cultures.
Discussion
Our results suggest that hippocampal neurons in dissociated cultures maintain synchronized activity patterns, which are reproducible between independent coverslips and preparations, as demonstrated by both calcium imaging and measurements of synaptic vesicle dynamics. At the same time, their transcriptomes also show a tendency to synchronize, albeit only one protein, RBM3, showed significant differences between different time points, when multiple cultures were considered. RBM3 manipulations resulted in profound changes in the neuronal activity patterns. A potential mechanism for the RBM3 function may be through its modulation of local translation in synapses (Fig. 7), which it appears to affect in a specific fashion, with less influence on global translation.
An important issue is why peaks of activity appear at similar time points across different cultures. We speculate that the time of making the cultures is relevant, and we kept this parameter constant throughout all experiments, with the rats being delivered at 10:00 A.M. to 11:00 A.M., and the resulting cultures placed in the incubator between 4:00 P.M. and 5:00 P.M. The density of the cultures may also influence their synchronization in terms of activity, as mentioned in the Introduction, and as detailed in the following paragraphs.
Activity patterns in dissociated hippocampal neurons
Primary hippocampal cultures are prepared from mechanically and enzymatically dissociated hippocampi. The loss of the third dimension is a dramatic change for the network dynamics. At the same time, not having hormonal and temporal input from other regions makes it more difficult to synchronize the neurons in a culture. This is already known from SCN cultures, where the neurons demonstrate individual rhythmicity (Welsh et al., 1995), and can maintain 24 h rhythmicity when plated at high densities (Honma et al., 1998), but lose rhythmicity when the network communication is perturbed (Yamaguchi et al., 2003). Together, these findings suggest that network communication is essential for rhythmicity and synchronization in cultures, and that low-density cultures will lose synchronization relatively rapidly.
In view of these arguments, it was unclear whether hippocampal neurons would be able to synchronize over long periods in the culture, as the SCN neurons do (Watanabe et al., 1993). Interestingly, our findings are consistent with the observations on SCN. Dissociated hippocampal neurons exhibit high or low activity at specific times of day/night, albeit a clear 24 h rhythmicity cannot be observed when averaging results across different cultures.
Neuronal activity was not the only factor that presented such a behavior. Presynaptic activity, synapse size, and mRNA amounts at the synapse also were changing throughout 24 h. These observations suggest that one of the most commonly used models for synaptic research, the primary hippocampal culture, has a time-dependent behavior. This makes it extremely important to acknowledge the timing of experiments performed with these cultures.
RBM3 connects molecular clock genes to neuronal function
It has been repeatedly demonstrated that the molecular clock regulates genes that control neuronal activity, as discussed in the Introduction. This makes them excellent candidates for the regulation of rhythmic activity in cultured neurons. Surprisingly, we did not find any of the core clock genes to have a very clear transcription pattern in these cultures, which implies that they may not be very well synchronized among different neurons and different cultures, unlike RMB3. This molecule has been found in many time-series transcriptomics datasets as a daily (24 h) rhythmic gene (Yan et al., 2008; Zhang et al., 2014; Pembroke et al., 2015; Renaud et al., 2015; Terajima et al., 2017; Noya et al., 2019; Ray et al., 2020), and its oscillations in expression may be independent of at least some components of the molecular clock, as they still persist in BMAL1 KO cells (Ray et al., 2020). Overall, our work cannot state whether the RBM3 oscillations are controlled by the central molecular clock machinery in hippocampal cultures. However, its stronger synchronization (across cultures) than that of the canonical clock genes implies that Rbm3 expression may be independent from them.
Other than being a rhythmically expressed gene in the literature, RBM3 is a cold-shock protein, whose expression is induced in hypothermia conditions. For example, keeping a culture at 32°C instead of 37°C for 24 h induces Rbm3 expression (Chappell et al., 2001; Yang et al., 2019). Such temperature changes are not possible in the wells of a closed plate in the incubator, which eliminates the possibility that Rbm3 expression was synchronized by temperature changes in our experiments.
As a cold shock protein, RBM3 activates the translation machinery. Several studies have demonstrated that RBM3 enhances polysome formation, by phosphorylation of translation initiation factors and by changing the miRNA level (Chappell et al., 2001; Dresios et al., 2005). RBM3 has been described to enhance the translation of specific genes in hypothermia, thereby protecting synaptogenesis (Yan et al., 2019; Zhu et al., 2019). Moreover, although RBM3 is primarily located at the nucleus, one isoform has been found in dendrites, where it colocalizes with a ribosomal protein (Smart et al., 2007). In summary, these observations suggest that RBM3 is important for synaptic function, probably because of its role in translation, and possibly in local synaptic translation. Our findings suggest that RBM3 does not change the overall mRNA availability in synapses, but that it specifically changes local translation in synapses, without affecting the global translation. This effect may result in strong changes in synaptic activity, as explained below.
RBM3 may regulate synaptic function through local translation
Local translation appears to be an essential resource for neurons, since they need to strengthen or prune their connections in response to changes in synaptic activity. This implies that new proteins, as synaptic receptors, need to be incorporated dynamically in synapses. As neurons have extremely long neurites (Ishizuka et al., 1995), transport from the cell body would probably fail to satisfy the protein turnover needs of the synapses. To cope with this logistics challenge, neurons would need to place the translation machinery in synapses.
For a long time, electron microscopy images of synapse have demonstrated the presence of polyribosomes in the dendritic shaft and in the postsynapse (Steward and Levy, 1982; Ostroff et al., 2018). Later studies have shown that other components of the translational machinery, such as tRNAs, translation initiation factors, and elongation factors are present in synapses (Steward and Levy, 1982; Tiedge and Brosius, 1996; Sutton and Schuman, 2006). Despite these observations, direct evidence for translation in all synaptic compartments, and especially in the presynapse, has been difficult to obtain until recent assays demonstrated this thoroughly for both synaptic boutons and dendritic spines (Hafner et al., 2019).
Functional data have also offered strong support to the idea that local translation is an important feature of the synapses. Synaptic plasticity has been shown to depend on local translation (Miller et al., 2002). This process has also been linked to memory formation (Jones et al., 2018). Furthermore, electrical activity can be affected by the local translation as well, as in the case of the calyx of Held (Scarnati et al., 2018), where the inhibition of protein synthesis enhances spontaneous activity.
Overall, these observations suggest that local translation has important effects on synaptic transmission, and hence on plasticity, which last for hours. It is therefore evident that disturbing local translation would affect synaptic transmission, which in turn would influence the general network activity, as we observed in RBM3 KD experiments.
To our knowledge, this is the first time that RBM3 has been linked to changes in local translation, or to long-term neuronal activity changes. At the same time, our work demonstrates that broad changes take place in neuronal activity depending on the time of day/night, even in a simple model like dissociated hippocampal neurons in culture. This suggests that these cultures, which are far more common than SCN cultures, could become a useful model for circadian rhythm studies. Finally, the link between RBM3 and local translation may provide substantial further insight in the future, especially as the local translation field is now rapidly progressing through numerous innovative tools and concepts (Holt et al., 2019).
Footnotes
The authors declare no competing financial interests.
The work was supported by Deutsche Forschungsgemeinschaft Grant SFB1286/A03 to S.O.R and Germany's Excellence Strategy - EXC 2067/1- 390729940. We thank Verena Klüver and Dr. Eugenio Fornasiero for the generous gift of the Scr shRNA plasmid; Roya Yousefi and Prof. Peter Rehling for the generous gift of puromycin, anisomycin, and puromycin antibody; Janina Pasch for help throughout the puromycin experiments (all from University Medical Center Göttingen); the Transcriptome and Genome Analysis Laboratory (Göttingen) for mRNA sequencing and analysis; Prof. Dr. Dörthe Katschinski (University Medical Center Göttingen) for access to viral production facilities; and Prof. Christopher S. Colwell (Brain Research Institute, University of California, Los Angeles) for comments on the manuscript.
- Correspondence should be addressed to Sinem M. Sertel at sinem.sertel{at}med.uni-goettingen.de or Silvio O. Rizzoli at srizzol{at}gwdg.de
This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license, which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed.