SorCS1 controls an axonal–dendritic balance in Nrxn1α surface polarization

We first determined the subcellular distribution of endogenous SorCS1, which has been difficult to assess because of a lack of suitable antibodies. We generated a SorCS1 knock-in (KI) mouse (Sorcs1^HA), using CRISPR/Cas9 to insert a hemagglutinin (HA) epitope tag in the Sorcs1 locus after the propeptide domain (S1A Fig). Correct insertion of the HA tag was confirmed by sequencing and western blot analysis (S1B Fig). HA immunodetection in cultured Sorcs1^HA cortical neurons revealed prominent punctate endogenous SorCS1 immunoreactivity in soma and dendrites (Fig 1A), which was mimicked by exogenously expressed HA-SorCS1 in hippocampal neurons (Fig 1B and 1C). These results are in agreement with a previous immunohistochemical study showing a somatodendritic distribution of SorCS1 [25] and suggest that SorCS1-mediated sorting of cargo proteins, including Nrxn, occurs in this cellular compartment.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 1. SorCS1-mediated sorting controls an axonal–dendritic surface balance of Nrxn1α.

(A) DIV9 Sorcs1^HA mouse cortical neurons immunostained for endogenous (endog.) HA-SorCS1 (grayscale and green) and MAP2 (blue). Red arrowheads indicate the axon, and the blue asterisk marks the cell body. High-zoom images show dendritic (dotted blue box) and axonal (dotted red box) distribution of HA-SorCS1. (B) DIV10 WT mouse hippocampal neurons transfected with HA-SorCS1 and immunostained for HA (grayscale). (C) Quantification of panels A and B: dendritic versus axonal distribution (D:A–polarity index) of endogenous (DIV9, n = 26 neurons and DIV14, n = 26) and exogenous (exog.; n = 14) HA-SorCS1 from 3 and 2 independent experiments, respectively. (D) DIV8 to DIV10 Sorcs1^flox/flox mouse cortical neurons electroporated with EGFP (Ctr), Cre-EGFP, Cre-EGFP-T2A-SorCS1^WT, or Cre-EGFP-T2A-SorCS1^Y1132A and transfected with HA-Nrxn1α, immunostained for surface (s.) HA-Nrxn1α (grayscale and green) and MAP2 (blue). (E) Quantification of panel D: surface HA-Nrxn1α fluorescence intensity in axon and dendrites relative to total surface levels and normalized to cells expressing EGFP, and ratio of axonal–dendritic surface HA intensity. Ctr (n = 27 neurons); Cre (n = 29); Cre_SorCS1^WT (n = 28); Cre_SorCS1^Y1132A (n = 28). ***P < 0.001 (Kruskal-Wallis test followed by Dunn’s multiple comparisons test, 3 independent experiments). Underlying numerical values can be found in S1 Data. Graphs show mean ± SEM. Scale bars, 20 μm (panel B); 5 μm (panel A [high-zoom], panel D). Cre, Cre recombinase; Ctr, control; DIV, days in vitro; EGFP, enhanced green fluorescent protein; HA, hemagglutinin; MAP2, microtubule-associated protein 2; Nrxn, neurexin; SorCS1, Sortilin-related CNS expressed 1; WT, wild type.

https://doi.org/10.1371/journal.pbio.3000466.g001

To begin to elucidate how SorCS1 regulates membrane trafficking of its cargo Nrxn, we electroporated cortical Sorcs1^flox/flox mouse neurons with Cre recombinase (Cre) to remove SorCS1 (Sorcs1 knock out [KO]). We transfected neurons with HA-Nrxn1α, one of the most abundant Nrxn isoforms in the brain [26], and live-labeled them with an HA antibody to detect surface Nrxn1α, followed by Ankyrin-G (AnkG) and microtubule-associated protein 2 (MAP2) immunodetection to label the axonal and dendritic compartment, respectively. Loss of SorCS1 decreased Nrxn1α axonal surface levels and concomitantly increased dendritic surface levels in the same cell, changing Nrxn1α surface polarization from axonal to dendritic (Fig 1D and 1E). Re-expression of WT SorCS1 (SorCS1^WT) in Cre-positive Sorcs1^flox/flox neurons restored Nrxn1α axonal surface polarization (Fig 1D and 1E), indicating that the defect occurred cell autonomously. In contrast, rescue with an endocytosis-defective mutant [27] of SorCS1 (SorCS1^Y1132A), which remains on the plasma membrane (S1C Fig and S1D Fig), did not rescue Nrxn1α surface polarization (Fig 1D and 1E). To determine whether SorCS1 controls the subcellular distribution of endogenous Nrxn, we immunostained Sorcs1^flox/flox neurons electroporated with Cre or enhanced green fluorescent protein (EGFP) with a pan-Nrxn antibody directed against the conserved cytoplasmic tail [28] (S1E Fig and S1F Fig), which specifically labels endogenous Nrxn (S1G Fig and S1H Fig). Similar to the observations with transfected HA-Nrxn1α in Sorcs1 KO neurons, loss of SorCS1 reduced axonal intensity of endogenous Nrxn and decreased the axonal–dendritic ratio compared with control neurons (S1E Fig and S1F Fig). Conversely, overexpression of SorCS1^WT in hippocampal neurons, which express very low levels of Sorcs1 [29], increased Nrxn1α axonal surface polarization and concurrently decreased dendritic surface levels, whereas overexpression of SorCS1^Y1132A did not alter Nrxn1α surface polarization (S1I Fig and S1J Fig). Together, these results indicate that somatodendritic SorCS1 controls an axonal–dendritic surface balance of Nrxn1α. Our findings suggest that SorCS1 is either required for endocytosis of Nrxn1α or acts in endosomes to bias Nrxn1α surface polarization toward the axon.

Indirect axonal surface trafficking of Nrxn1α in mature neurons

Nrxns are considered to be predominantly presynaptic proteins, although several independent studies have reported the presence of a dendritic pool of Nrxns [20,30–33]. To unequivocally determine the subcellular localization of endogenous Nrxn, we generated a Nrxn1α KI mouse (Nrxn1α^HA), inserting an HA epitope tag in the Nrxn1α locus after the signal peptide (S2A Fig). Correct insertion of the HA tag was confirmed by restriction digest, sequencing, and western blot analysis (S2B Fig). We cultured Nrxn1α^HA cortical neurons together with WT cortical neurons to reliably detect endogenous HA-Nrxn1α in the somatodendritic and axonal compartment (S2C Fig and S2D Fig). At 3 days in vitro (DIV), HA-Nrxn1α surface distribution was polarized towards the axon (Fig 2A and 2B). As neurons matured, surface HA-Nrxn1α axonal surface levels decreased, whereas dendritic surface levels increased (Fig 2A and 2B). Surface HA-Nrxn1α remained polarized towards the axon at all developmental time points analyzed (Fig 2A and 2B). A similarly polarized distribution of Nrxn was observed in WT neurons labeled with the pan-Nrxn antibody (S2E Fig and S2F Fig). Together, these results indicate that endogenous Nrxn1α is an axonally polarized surface protein that accumulates in dendrites as neurons mature.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 2. Indirect axonal trafficking of Nrxn1α in mature neurons.

(A) Nonpermeabilized DIV3, DIV7, and DIV11 Nrxn1α^HA cortical neurons live-labeled with an HA antibody to visualize endogenous surface (s.) HA-Nrxn1α (grayscale) in axon and dendrites. Red arrowheads indicate the axon, and the blue asterisk marks the cell body. (B) Quantification of panel A: surface HA-Nrxn1α fluorescence intensity in axon and dendrites normalized to DIV3 neurons and the ratio of axonal–dendritic surface HA-Nrxn1α intensity. DIV3 (n = 30 neurons); DIV7 (n = 29); DIV11 (n = 24). **P < 0.01; ***P < 0.001 (Kruskal-Wallis test followed by Dunn’s multiple comparisons test, 3 independent cultures). (C) Schematic representation of streptavidin-KDEL (ER hook) and reporters (Nrxn1α and TfR) used in RUSH experiments. Addition of biotin dissociates the reporters from the ER hook, inducing synchronous release from the ER and transport through the secretory pathway. (D) DIV9 WT mouse cortical neuron co-expressing SBP-EGFP-Nrxn1α and streptavidin-KDEL immunostained for MAP2 (blue), Ankyrin-G (red), and EGFP-Nrxn1α (grayscale and green) at t = 0 before adding biotin. (E) Live-cell imaging in DIV8 to DIV10 WT rat cortical neurons co-expressing SBP-EGFP-Nrxn1α and ER hook. After 24 to 31 h of expression, neurons were imaged every 5 min for 2.5 h. Biotin was added 10 min after the beginning of the imaging session. Shown are representative images of SBP-EGFP-Nrxn1α fluorescence in dendrites and axon before (t0) and 30, 60, 90 and 120 min after adding biotin. Red arrowheads indicate axon and black arrows indicate SBP-EGFP-Nrxn1α-positive puncta. See also S1 Movie. (F–I) Live-cell imaging in DIV8 to DIV10 WT rat cortical neurons co-expressing SBP-EGFP-Nrxn1α and ER hook. After 21 to 30 h of expression, neurons were imaged every second for 60 to 120 s either 20 to 34 min or 1 to 2 h after adding biotin. See also S2 Movie and S3 Movie. (F) Kymographs illustrating EGFP-Nrxn1α vesicle dynamics over a 60 s period in dendrites (D) from neurons treated with biotin for either 25 min or 2 h. (G) Mean number of motile and nonmotile EGFP-Nrxn1α vesicles in dendrites from neurons treated with biotin for either 20 to 34 min (n = 17 neurons) or 1 to 2 h (n = 16) in 2 and 3 independent experiments, respectively. *P < 0.05 (Mann-Whitney test). (H) Kymographs illustrating EGFP-Nrxn1α vesicle dynamics over a 60 s period in axons (A) from neurons treated with biotin for either 25 min or 2 h. (I) Mean number of motile and nonmotile EGFP-Nrxn1α vesicles in axons. ***P < 0.001 (Mann-Whitney test). Underlying numerical values can be found in S1 Data. Graphs show mean ± SEM. Scale bars, 20 μm (panels A and D); 10 μm (panel E). AnkG, Ankyrin-G; DIV, days in vitro; ER, endoplasmic reticulum; EGFP, enhanced green fluorescent protein; HA, hemagglutinin; KDEL, endoplasmic reticulum retention signal KDEL; KI, knock in; MAP2, microtubule-associated protein 2; Nrxn, neurexin; RUSH, retention using selective hooks; SBP, streptavidin-binding protein; TfR, transferrin receptor; WT, wild type.

https://doi.org/10.1371/journal.pbio.3000466.g002

To determine how Nrxn1α is trafficked in cortical neurons, we employed the retention using selective hooks (RUSH) system [34] to retain Nrxn1α in the endoplasmic reticulum (ER) and induced synchronous release and transport through the secretory pathway by applying biotin (Fig 2C). We performed live-cell imaging in 8 through 10 DIV rat cortical neurons co-expressing streptavidin-binding protein (SBP)-EGFP-Nrxn1α (reporter) and streptavidin-ER retention signal KDEL (KDEL) (ER hook), which were live-labeled with an antibody against the axon initial segment (AIS) protein Neurofascin to visualize the axonal compartment (S3A Fig). At t = 0, we observed diffuse SBP-EGFP-Nrxn1α fluorescence in soma and dendrites, in a pattern resembling the ER (Fig 2D). Following application of biotin, Nrxn1α fluorescence coalesced into punctate structures that started trafficking abundantly in the somatodendritic compartment, followed by Nrxn1α trafficking in the axon after a marked delay (Fig 2E, S1 Movie). Quantification of Nrxn1α fluorescence intensity showed a decrease in Nrxn1α intensity in the soma and an increase in axonal intensity approximately 90 min after biotin application (S3B Fig). Kymograph analysis showed a small increase in the mean number of motile vesicles present in dendrites at late (1–2 h) compared with early (20–34 min) time points (Fig 2F and 2G, S2 Movie, S3 Movie). Shortly after ER release, the majority of vesicles in dendrites moved in the anterograde direction, shifting to a retrograde movement at the later time point (S3C Fig). Strikingly, motile Nrxn1α vesicles were absent in axons shortly after ER release but increased dramatically at late time points (Fig 2H and 2I, S2 Movie, S3 Movie). The vast majority of these vesicles moved anterogradely (S3D Fig).

We performed several controls to verify that the delayed axonal trafficking of Nrxn1α is not an artefact of prolonged retention in the ER and synchronized release, which might overwhelm the trafficking machinery. Trafficking of the somatodendritic cargo protein transferrin receptor (TfR) [35] was detected only in the somatodendritic compartment (S3E Fig and S3F Fig, S4 Movie). In the absence of biotin, dendritic SBP-EGFP-Nrxn1α-positive structures were not motile (S5 Movie), indicating that the delayed trafficking of Nrxn1α to axons is not simply caused by prolonged ER retention. Moreover, immature DIV3 neurons displayed Nrxn1α trafficking to the axonal compartment shortly after biotin application (S3G Fig and S3H Fig, S6 Movie), further indicating that the delayed axonal trafficking of Nrxn1α in mature neurons does not result from prolonged retention in the ER but correlates with the maturation state of the neuron. Taken together, these results show that following transport through the secretory pathway, Nrxn1α is first trafficked to the somatodendritic compartment and appears in axons with a marked delay.

Nrxn1α is transcytosed from the dendritic surface to axons

Our observations suggest a dendrite-to-axon transcytotic pathway for axonal surface polarization of Nrxn1α. The transcytotic model predicts that Nrxn1α is first trafficked to the somatodendritic plasma membrane, where it is internalized into endosomes and trafficked to the axonal compartment via endosome-derived carriers [36]. To determine whether Nrxn1α is internalized from the dendritic plasma membrane, we followed the fate of Nrxn1α throughout the endosomal pathway. Internalised Nrxn1α was largely restricted to the dendritic compartment (S4A Fig and S4B Fig) and shifted from early endosomes (EEs; early endosome antigen 1 [EEA1]- and Rab5-positive) to recycling endosomes (REs; Rab11-positive) over time (S4C–S4I Fig). Blocking of dynamin-dependent endocytosis, either by expressing a dominant-negative (DN) mutant of Dynamin1 (K44A) or with Dynasore (S5A–S5D Fig), caused a decrease in Nrxn1α axonal surface levels and a concomitant increase in dendritic surface levels. Expression of GTP binding-deficient mutants of Rab5 (S34N) and Rab11 (S25N) to interfere with transport to EEs and REs, respectively, mimicked the effect of blocking endocytosis (S5E–S5H Fig). However, expression of Rab7 (T22N) to interfere with transport to late endosomes did not affect the axonal surface polarization of Nrxn1α (S5I Fig and S5J Fig). Thus, endocytosis, EE and RE transport, but not late endosomal transport, are required for accumulation of Nrxn1α on the axonal plasma membrane, indicating transcytotic trafficking of Nrxn1α.

A SorCS1-Rab11FIP5 interaction controls Nrxn1α transition from early to REs

The transcytotic trafficking route of Nrxn1α and somatodendritic distribution of SorCS1 suggest that sorting of Nrxn1α occurs in dendrites. To determine how SorCS1 controls transcytotic trafficking of Nrxn1α, we followed the fate of internalized HA-Nrxn1α in Sorcs1 KO neurons. Endocytosis of HA-Nrxn1α in dendrites was not affected in Sorcs1 KO neurons compared with control cells (S6A Fig and S6B Fig). We next analyzed colocalization of internalized Nrxn1α with EEs (EAA1), fast REs (Rab4), REs (Rab11) in dendrites, and REs (Rab11) in the axon, respectively, of Sorcs1 KO neurons. Quantification revealed an increase in the colocalization of internalized Nrxn1α with EAA1-positive EEs and Rab4-positive fast REs in dendrites of Sorcs1 KO neurons (Fig 3A–3D). Colocalization of internalized Nrxn1α with Rab11-positive REs in Sorcs1 KO neurons was decreased in dendrites (Fig 3E and 3F) and even more strongly reduced in the axon (Fig 3G and 3H). Thus, endocytosed Nrxn1α accumulates in EEs and is missorted to Rab4-fast REs in the absence of SorCS1-mediated sorting. These observations are consistent with our finding that dendritic surface levels of Nrxn1α are increased in Sorcs1 KO neurons (Fig 1D and 1E), which is likely due to increased recycling of Nrxn1α via Rab4-fast REs back to the dendritic plasma membrane. Similarly, the reduced axonal surface levels of Nrxn1α in Sorcs1 KO neurons (Fig 1D and 1E) likely result from decreased sorting of Nrxn1α to Rab11-REs. Together, these results demonstrate that SorCS1 controls axonal surface polarization of Nrxn1α by facilitating the transition from EEs to Rab11-REs.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 3. SorCS1 interacts with Rab11FIP5/Rip11 to regulate Nrxn1α transition from EEs to REs.

(A) DIV8 to DIV10 Sorcs1^flox/flox cortical neurons electroporated with mCherry (Ctr) or Cre-T2A-mCherry and transfected with HA-Nrxn1α (pulse-chased for 20 min), labeled for internalized (int.) HA-Nrxn1α (grayscale and green) and EEA1 (grayscale and red). (B) Quantification of panel A: number of internalized Nrxn1α- and EEA1-double-positive puncta normalized to cells expressing mCherry and intensity of internalized Nrxn1α fluorescence in the double-positive puncta normalized to cells expressing mCherry. Ctr (n = 26 neurons); Cre (n = 25). *P < 0.05; ***P < 0.001 (Mann-Whitney test, 3 independent experiments). (C) DIV8 to DIV10 Sorcs1^flox/flox cortical neurons electroporated with mCherry (Ctr) or Cre-T2A-mCherry and co-transfected with HA-Nrxn1α and EGFP-Rab4 (pulse-chased for 25 min), labeled for internalized HA-Nrxn1α (grayscale and green) and EGFP-Rab4 (grayscale and red). (D) Quantification of panel C; Ctr (n = 28 neurons); Cre (n = 26). **P < 0.01 (Mann-Whitney test, 3 independent experiments). (E) DIV8 to DIV10 Sorcs1^flox/flox cortical neurons electroporated with mCherry (Ctr) or Cre-T2A-mCherry and co-transfected with HA-Nrxn1α and EGFP-Rab11 (pulse-chased for 40 min), labeled for internalized HA-Nrxn1α (grayscale and green) and EGFP-Rab11 (grayscale and red). (F) Quantification of panel E; Ctr (n = 29 neurons); Cre (n = 23). *P < 0.05 (Mann-Whitney test, 3 independent experiments). (G) DIV8 to DIV10 Sorcs1^flox/flox cortical neurons electroporated with mCherry (Ctr) or Cre-T2A-mCherry and co-transfected with HA-Nrxn1α and EGFP-Rab11 (pulse-chased for 90 min), labeled for internalized HA-Nrxn1α (grayscale and green) and EGFP-Rab11 (grayscale and red). (H) Quantification of panel G; Ctr (n = 28 neurons); Cre (n = 26). ***P < 0.001 (Mann-Whitney test, 3 independent experiments). (I) Western blot for the recovery of Rab11FIP5/Rip11 in immunoprecipitated HA-SorCS1 complexes from P21–P28 Sorcs1^HA cortical prey extracts. See S9 Fig for raw uncropped blots. (J) DIV9 to DIV10 WT cortical neurons co-expressing EGFP-Rip11 and SorCS1cβ-myc immunostained for EGFP-Rip11 (grayscale and green), SorCS1-myc (grayscale and red) and MAP2 (blue). (K) Quantification of the colocalization of Rip11 with SorCS1 expressed as Manders coefficient (n = 20 neurons) in 2 independent experiments. (L) DIV9 WT cortical neurons co-expressing HA-Nrxn1α and EGFP (Ctr), WT EGFP-Rip11 or DN EGFP-Rip11, and immunostained for surface (s.) HA-Nrxn1α (grayscale). Red arrowheads indicate the axon, and the blue asterisk marks the cell body. (M) Quantification of panel L: surface HA-Nrxn1α fluorescence intensity in axon and dendrites relative to total surface levels and normalized to cells expressing EGFP and ratio of axonal–dendritic surface HA intensity (n = 30 neurons for each group). *P < 0.05; ***P < 0.001 (Kruskal-Wallis test followed by Dunn’s multiple comparisons test, 3 independent experiments). Underlying numerical values can be found in S1 Data. Graphs show mean ± SEM. Scale bars, 5 μm (panels G and J); 20 μm (panel L). Cre, Cre recombinase; Ctr, control; DIV, days in vitro; DN, dominant negative; EE, early endosome; EEA1, early endosome antigen 1; EGFP, enhanced green fluorescent protein; HA, hemagglutinin; MAP2, microtubule-associated protein 2; Nrxn, neurexin; Rab, Rab GTPase; RE, recycling endosome; Rip11, Rab11 interacting protein; SorCS1, Sortilin-related CNS expressed 1; WT, wild type.

https://doi.org/10.1371/journal.pbio.3000466.g003

We reasoned that SorCS1 might interact with additional proteins to facilitate Nrxn1α sorting from early to REs. Rab11FIP5 or Rip11 is prominently present in the raw mass spectrometry (MS) data set we obtained after affinity purification (AP) of SorCS1 complexes from rat brain extracts with 2 independent antibodies [20] (AP-MS data available online). Rip11, which belongs to the family of Rab11-interacting proteins [37], localizes to REs and regulates transcytosis of proteins from the basolateral to the apical plasma membrane in polarized epithelial cells [38,39]. Western blot analysis of immunoprecipitated HA-SorCS1 from postnatal Sorcs1^HA KI cortical extracts showed a robust Rip11 band coprecipitating with SorCS1 but not with control mouse immunoglobulin G (IgG) (Fig 3I). Rip11 displayed a punctate distribution in dendrites and colocalized with SorCS1 (Fig 3J and 3K). Expression of a DN form of Rip11 that inhibits the transport from early to REs [40] reduced axonal surface levels of HA-Nrxn1α and increased dendritic surface levels, shifting Nrxn1α surface polarization from axonal to dendritic (Fig 3L and 3M), similar to loss of SorCS1. Expression of WT Rip11, on the other hand, increased axonal surface polarization of HA-Nrxn1α (Fig 3L and 3M). Together, these results demonstrate that a SorCS1-Rip11 interaction facilitates Nrxn1α sorting from EEs to REs, preventing missorting to fast REs and late endosomes and biasing trafficking to the axonal surface.

Selective missorting of transcytotic cargo in the absence of SorCS1

We next asked whether the surface polarization of other axonal membrane proteins was affected in the absence of SorCS1. The cell adhesion molecules neuron-glia cell adhesion molecule L1 (L1/NgCAM) and contactin-associated protein-like 2 (Caspr2) are both targeted to the axonal surface but via distinct trafficking routes. L1/NgCAM is transcytosed from dendrites to axon [41,42], whereas Caspr2 undergoes nonpolarized delivery followed by selective endocytosis from the somatodendritic surface resulting in axonal polarization [43]. L1/NgCAM levels are down-regulated in Sorcs1 KO synaptosomes [20]. Sorcs1^flox/flox cortical neurons electroporated with Cre or EGFP were transfected with myc-L1 or HA-Caspr2 and immunostained for surface myc or HA. Consistent with a role for SorCS1 in regulating transcytosed axonal cargo, surface polarization of L1/NgCAM, but not of Caspr2, was perturbed in Sorcs1 KO neurons (S6C–S6E Fig). The polarity index of 2 somatodendritic proteins (glutamate ionotropic receptor AMPA type subunit 2 [GluA2-EGFP] and MAP2) was unchanged in Sorcs1 KO neurons (S7 Fig), indicating that loss of SorCS1 does not generally perturb the polarized distribution of neuronal proteins. Thus, loss of SorCS1 selectively impairs transcytotic trafficking of axonal membrane proteins, while keeping other neuronal polarity mechanisms intact.

Loss of SorCS1 impairs Nrxn-mediated presynaptic differentiation

We next sought to determine motifs in the Nrxn1α protein sequence that contain signals necessary for its membrane trafficking, with the goal of identifying a Nrxn1α mutant that can bypass SorCS1-mediated sorting and transcytotic trafficking. We systematically tested the effect of a series of Nrxn1α cytoplasmic deletions on surface polarization (Fig 4A and 4B, S8A–S8C Fig) and found that removing the 4.1-binding motif in the cytoplasmic domain (Nrxn1α Δ4.1) was the only deletion that dramatically increased Nrxn1α axonal surface polarization (Fig 4A and 4B, S8A–S8C Fig). Remarkably, axonal surface polarization of Nrxn1α Δ4.1 was unaffected by loss of SorCS1 (Fig 4C and 4D). Moreover, Dynasore treatment to block endocytosis did not impair axonal surface polarization of Nrxn1α Δ4.1 (Fig 4E and 4F), indicating that the Nrxn1α Δ4.1 mutant bypasses dendritic endocytosis and sorting by SorCS1 to polarize to the axonal surface.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 4. SorCS1-mediated axonal surface polarization of Nrxn is required for presynaptic differentiation.

(A) DIV8 to DIV10 WT mouse cortical neurons transfected with WT HA-Nrxn1α and a cytoplasmic deletion mutant lacking the 4.1-binding motif (HA-Nrxn1α Δ4.1) and immunostained for surface (s.) HA-Nrxn1α (grayscale). Red arrowheads indicate the axon, and the blue asterisk marks the cell body. High-zoom images show dendritic (D, dotted blue box) and axonal (A, dotted red box) HA-Nrxn1α. (B) Quantification of panel A: surface HA-Nrxn1α fluorescence intensity in axon and dendrites relative to total surface levels and normalized to cells expressing WT-Nrxn1α and ratio of axonal–dendritic surface HA intensity. WT (n = 30 neurons); Δ4.1 (n = 29). ***P < 0.001 (Mann-Whitney test, 3 independent experiments). (C) DIV8 to DIV10 mouse Sorcs1^flox/flox cortical neurons electroporated with EGFP (Ctr) or Cre-EGFP (Cre) and transfected with WT HA-Nrxn1α or HA-Nrxn1α Δ4.1. Neurons were immunostained for surface HA-Nrxn1α (grayscale). (D) Quantification of panel C: ratio of axonal–dendritic surface HA-Nrxn1α fluorescence intensity. Ctr_WT (n = 46 neurons); Ctr_Δ4.1 (n = 25); Cre_WT (n = 30); Cre_Δ4.1 (n = 27). **P < 0.01; ***P < 0.001 (Kruskal-Wallis test followed by Dunn’s multiple comparisons test, at least 3 independent experiments). (E) DIV8 to DIV10 WT mouse cortical neurons transfected with WT HA-Nrxn1α or HA-Nrxn1α Δ4.1 and treated with DMSO (vehicle) or Dynasore. Neurons were immunostained 18 h after treatment for surface HA-Nrxn1α (grayscale). (F) Quantification of panel E: ratio of axonal–dendritic surface HA fluorescence intensity. WT_DMSO (n = 40 neurons); Δ4.1_DMSO (n = 40); Δ4.1_Dynasore (n = 28). ***P < 0.001 (Kruskal-Wallis test followed by Dunn’s multiple comparisons test, at least 3 independent experiments). (G) HEK293T-cells expressing FLAG-Nlgn1 co-cultured with DIV10 Sorcs1^flox/flox cortical neurons infected with LV expressing mCherry (Control), Cre-T2A-mCherry, Cre-T2A-mCherry-T2A-WT Nrxn1α, Cre-T2A-mCherry-T2A-Nrxn1α Δ4.1, or Nrxn TKD; immunostained for FLAG (blue) and Synapsin1 (grayscale and green). (H) Quantification of panel G: the area of Synapsin1 clustering on the surface of Nlgn1-expressing HEK cells and normalized to cells expressing mCherry. Control (n = 29 neurons); Cre (n = 30); Cre-WT (n = 30); Cre-Δ4.1 (n = 30); TKD Nrxns (n = 30). *P < 0.05; ***P < 0.001 (Kruskal-Wallis test followed by Dunn’s multiple comparisons test, 3 independent experiments). (I) HEK293T-cells expressing NGL-3-EGFP co-cultured with DIV10 Sorcs1^flox/flox cortical neurons infected with LV expressing mCherry (Control) or Cre-T2A-mCherry and immunostained for EGFP (blue) and Synapsin1 (grayscale and green). (J) Quantification of panel I. Control (n = 30 neurons); Cre (n = 30). Underlying numerical values can be found in S1 Data. Graphs show mean ± SEM. Scale bars, 20 μm (panels A, C, and E); 5 μm (panels A [high-zoom], G, and I). Cre, Cre recombinase; Ctr, control; DIV, days in vitro; EGFP, enhanced green fluorescent protein; HA, hemagglutinin; HEK293T, human embryonic kidney cells; LV, lentivirus; NGL-3, Netrin-G Ligand 3; Nrxn, neurexin; NS, nonsignificant; SorCS1, Sortilin-related CNS expressed 1; TKD, triple knock down; WT, wild type.

https://doi.org/10.1371/journal.pbio.3000466.g004

Nrxn missorting to the dendritic surface and its concomitant loss from the axonal surface in Sorcs1 KO neurons would be expected to impair synapse formation on heterologous cells expressing a postsynaptic ligand for Nrxn [44]. To test this, we infected Sorcs1^flox/flox cortical neurons with lentivirus (LV) to express Cre-T2A-mCherry or mCherry as control and co-cultured these with HEK293T cells expressing the Nrxn ligand FLAG-Neuroligin 1 (Nlgn1). Nlgn1-induced clustering of the presynaptic marker Synapsin 1 was reduced in Sorcs1 KO axons compared with control axons (Fig 4G and 4H). This defect was specific, because presynaptic differentiation induced by Netrin-G Ligand 3 (NGL-3), which requires presynaptic leukocyte common antigen-related protein (LAR) [45], was not affected in Sorcs1 KO neurons (Fig 4I and 4J). Infection with a lentiviral vector expressing short hairpin ribonucleic acids (shRNAs) against all Nrxns (Nrxn triple knock down [TKD]) [46] mimicked the defect in Sorcs1 KO neurons (Fig 4G and 4H), suggesting that Nlgn1-induced presynaptic differentiation is impaired in Sorcs1 KO neurons because of decreased axonal surface levels of Nrxn. To test this, we overexpressed HA-Nrxn1α in Sorcs1 KO neurons using LV. As expected, WT Nrxn1α did not rescue the impaired Nlgn1-mediated synaptogenic activity (Fig 4G and 4H) because of Nrxn1α mispolarization to the dendritic surface in Sorcs1 KO neurons. In contrast, expression of the Nrxn1α Δ4.1 mutant, which bypasses SorCS1-mediated sorting and the transcytotic route to polarize to the axonal surface, rescued the synaptogenic defect caused by SorCS1 loss (Fig 4G and 4H). Together, these results show that SorCS1-mediated sorting of Nrxns, by promoting Nrxn accumulation on the axonal surface, is required for normal synaptogenesis onto Nlgn1-expressing cells.

SorCS1-mediated sorting is required for presynaptic function

Missorting of Nrxns, which regulate neurotransmitter release [5–7], would also be expected to impair presynaptic function. To assess the consequences of loss of SorCS1 on synaptic function, we recorded spontaneous miniature excitatory postsynaptic currents (mEPSCs) from Sorcs1^flox/flox autaptic cortical cultures electroporated with Cre or EGFP. SorCS1 loss strongly decreased mEPSC frequency (Fig 5A and 5B). Decay kinetics and amplitude of mEPSCs were not altered by loss of SorCS1 (Fig 5A and 5B), suggesting that the amount of neurotransmitter release per vesicle and postsynaptic receptor properties and/or receptor density were not affected. The amplitude and total charge transfer of single evoked EPSCs (eEPSCs) were reduced in Sorcs1 KO neurons (Fig 5C and 5D). The mEPSC frequency and eEPSC amplitude defects can be attributed to a decrease in the readily releasable pool (RRP) size, in the vesicular release probability (Pves), or in active synapse number. Indeed, we previously found an increase in the number of silent excitatory synapses after loss of SorCS1 [20]. To assess RRP size, we applied a hyperosmotic sucrose stimulus. The amplitude and total charge transfer of synaptic responses (Fig 5E and 5F) and RRP size (Fig 5G) induced by single application of 0.5 M sucrose were strongly decreased in Sorcs1 KO neurons, in line with a reduction in active synapse number. Because eEPSC amplitude and RRP size were proportionally reduced in Sorcs1 KO cells, the Pves (eEPSC charge/initial sucrose charge) was unchanged (Fig 5H). To further examine potential presynaptic release defects in Sorcs1 KO neurons, we performed train stimulations at different frequencies to probe for short-term plasticity defects that cannot be detected by induction of single EPSC and single sucrose application. Repeated stimulation at 10 Hz produced a more pronounced rundown of normalized evoked responses (synaptic depression) in Sorcs1 KO neurons compared with control cells (Fig 5I and 5J), suggesting a presynaptic defect during sustained periods of activity. Other stimulation frequencies and paired-pulse stimulations also showed increased synaptic depression in SorCS1 KO neurons (Fig 5K). Calculating the RRP size by back-extrapolation of cumulative synchronous charge during 10 Hz train stimulation confirmed a reduction in RRP size in Sorcs1 KO neurons (Fig 5L), indicating a presynaptic defect independent of the silent synapses phenotype that we described previously [20]. Together, these observations indicate that loss of SorCS1 impairs neurotransmitter release, reminiscent of Nrxn loss-of-function [5–7], indicating that SorCS1-mediated sorting of Nrxns in dendrites is required for normal presynaptic function.

Download:

• PPT
  PowerPoint slide
• PNG
  larger image
• TIFF
  original image

Fig 5. SorCS1 is required for presynaptic function.

(A) Example traces of mEPSCs recorded from DIV14 to DIV16 Sorcs1^flox/flox autaptic cortical neurons electroporated with EGFP (Control) or Cre-EGFP (Cre). (B) mEPSC frequency, but not amplitude and decay time, is decreased in Sorcs1 KO neurons. Control (n = 18 neurons); Cre (n = 15). ***P < 0.001 (Mann-Whitney test, 3 independent experiments). (C) Example traces of eEPSCs recorded from DIV14 to DIV16 Sorcs1^flox/flox autaptic cortical neurons electroporated with EGFP or Cre-EGFP. (D) eEPSC amplitude and eEPSC charge are decreased in Sorcs1 KO neurons. Control (n = 17 neurons); Cre (n = 14). *P < 0.05 (Mann-Whitney test, 3 independent experiments). (E) Example traces of sucrose responses recorded from DIV14 Sorcs1^flox/flox autaptic cortical neurons electroporated with EGFP or Cre-EGFP. (F–H) Decreased eEPSC amplitude, eEPSC charge (F) and RRP size (G) in Sorcs1 KO neurons, but unaltered Pves (H). Control (n = 17 neurons); Cre (n = 21). *P < 0.05; **P < 0.01 (Mann-Whitney test, 3 independent experiments). (I) Example traces of train stimulations (10 Hz) recorded from DIV14 to DIV16 Sorcs1^flox/flox autaptic cortical neurons electroporated with EGFP or Cre. (J) Increased depression during 10 Hz stimulation in Sorcs1 KO neurons. Control (n = 18 neurons); Cre (n = 13); 3 independent experiments. (K) Increased paired-pulse depression in Sorcs1 KO neurons throughout different interstimulation intervals. Control (n = 18 neurons); Cre (n = 14). *P < 0.05 (two-tailed t test, 3 independent experiments). (L) Estimation of the RRP size used during neuronal activity by back-extrapolating a linear fit of the steady state current towards the ordinate axis intercept, which represents the initial RRP size before train stimulations (10 Hz). RRP size of active synapses was reduced in DIV14 to DIV16 Sorcs1 KO neurons. Control (n = 18 neurons); Cre (n = 13). **P < 0.01 (Mann-Whitney test, 3 independent experiments). Underlying numerical values can be found in S1 Data. Graphs show mean ± SEM. Cre, Cre recombinase; DIV, days in vitro; eEPSC, evoked excitatory postsynaptic current; EGFP, enhanced green fluorescent protein; KO, knock out; mEPSC, miniature excitatory postsynaptic current; RRP, readily releasable pool; SorCS1, Sortilin-related CNS expressed 1.

https://doi.org/10.1371/journal.pbio.3000466.g005

A SorCS1-Rab11FIP5/Rip11 interaction sorts axonal cargo from EEs to REs

The mechanism by which SorCS1 regulates trafficking of neuronal receptors has remained unclear. We find that SorCS1 controls a balance between axonal and dendritic surface polarization of its cargo Nrxn. In mature neurons, newly synthesized Nrxn1α traffics to the somatodendritic surface, followed by endocytosis and transcytosis to the axon. Accordingly, blocking endocytosis, EE-, and RE-mediated transport all result in accumulation of Nrxn1α on the dendritic surface. These effects are mimicked by Sorcs1 KO. We find that endosomal SorCS1 controls the transition of endocytosed Nrxn1α from EEs to REs and identify the Rab11-interacting protein Rab11FIP5/Rip11 as a novel SorCS1 cytoplasmic interactor. Interference with Rip11 function alters the axonal–dendritic surface balance of Nrxn1α in the same way that Sorcs1 KO does. Rab11FIPs function as linkers between Rab11 and motor proteins to promote sorting of cargo from EEs to REs [37,47] and transcytosis in polarized epithelial cells [38,39], but their function in neuronal transcytosis has not been explored. Our data suggest that SorCS1/Rip11 form a protein complex that localizes to dendritic endosomes and sorts internalized Nrxn1α from early to recycling endosomes, thereby biasing the trafficking of Nrxn1α-containing REs to the axon while preventing Nrxn1α missorting to the dendritic surface and lysosomes.

SorCS1-mediated sorting of Nrxn1α in dendrites can be circumvented by deleting the 4.1-binding motif in the cytoplasmic tail of Nrxn1α, which results in strong polarization of Nrxn1α to the axonal surface. Surface polarization of Nrxn1α Δ4.1 is unaffected by blocking endocytosis or removing Sorcs1. It remains to be determined whether Nrxn1α’s 4.1-binding motif, which lacks canonical YXXØ and (D/E)XXXL(L/I) dendritic sorting motifs [48] but contains several tyrosine residues, is required for initial sorting to dendrites or for insertion in the dendritic membrane. Binding of the α-amino-3-hydroxy-5-methyl-4-isoxazole propionic-type receptor (AMPAR) subunit GluA1 to the 4.1N protein is required for GluA1 membrane insertion [49]. We find that the extracellular domain of Nrxn1α is required for somatodendritic sorting (S8D Fig and S8E Fig), suggesting that deletion of the 4.1-binding motif in Nrxn1α impairs dendritic insertion but not initial sorting to this compartment.

Our results show that loss of SorCS1 impairs transcytotic trafficking of Nrxn and L1/NgCAM, but not of Caspr2, which traffics via the selective endocytosis/retention pathway, supporting a role for SorCS1 in regulating transcytotic trafficking of axonal cargo proteins. It is unlikely that all membrane proteins that have been identified using surface proteome analysis to depend on SorCS1-3 for their surface trafficking [20,23,24] undergo transcytosis. The SorCS1 cargo amyloid precursor protein (APP) [50–52], however, is transcytosed in human neurons [53]. SorCS1 likely interacts with additional proteins, such as the retromer complex [50], to regulate the surface trafficking of a diverse set of cargoes.

SorCS1-mediated surface polarization of Nrxn is required for presynaptic differentiation and function

The selective impairment in Nlgn1-induced presynaptic differentiation in Sorcs1 KO neurons and rescue thereof by Nrxn1α Δ4.1, but not by WT Nrxn1α, indicates that this defect is due to a decrease in the abundance of axonal surface Nrxns. Nrxns play key roles in neurotransmitter release [5–7]. Alpha-Nrxn KO in neocortical cultured slices reduces mEPSC/miniature inhibitory postsynaptic current (mIPSC) frequency and evoked inhibitory postsynaptic current (eIPSC) amplitude [7]. β-Nrxn KO in cortical neurons decreases mEPSC frequency and eEPSC amplitude [5]. Our results show that loss of SorCS1 in autaptic cortical neurons decreases mEPSC frequency, eEPSC amplitude, and sucrose-evoked responses, in line with the reported decreased fraction of active synapses in Sorcs1 KO neurons [20]. Whether this decrease in the fraction of active synapses is also happening in autaptic cultured neurons requires further experimental testing. Furthermore, we found an increase in synaptic depression of normalized eEPCSs during stimulus trains, similar to α-Nrxn KO neurons [7]. Together, these results suggest that mistrafficking of Nrxn is a major contributor to the defects in presynaptic function in Sorcs1 KO neurons. These defects are likely attributed to a decrease in active synapse number and a presynaptic defect in neurotransmitter release, rather than a decrease in excitatory synapse density, which is unaffected in cultured Sorcs1 KO cortical neurons [20] and in Nrxn TKD hippocampal neurons [46].

The axonal–dendritic balance of Nrxn1α is developmentally regulated. Early in neuronal development, endogenous Nrxn1α is enriched on the axonal surface and traffics directly to the axon after trans-Golgi network (TGN) exit. As neurons mature, Nrxn1α follows an indirect trafficking pathway after TGN exit via SorCS1-mediated sorting in dendritic endosomes and transcytosis to the axonal surface. It will be interesting to determine whether expression of Sorcs1 and Rip11 is developmentally regulated in these neurons. The biological function of this developmental regulation and circuitous trafficking route is not clear. Transcytosis could provide an efficient way of delivering receptors from a reservoir of readily synthesized proteins. Similar to other transcytosed axonal cargo, a dendritic pool of Nrxn may supply the demand for receptors along the axonal surface, either constitutively [54,55] or in response to ligand-receptor interactions and signalling [54,56].

Dendritically localized Nrxns might have a function in this compartment. Postsynaptically expressed Nrxn1 decreases Nlgn1’s synaptogenic effect in hippocampal neurons, likely by cis-inhibition of Nlgn1 [32]. In retinal ganglion cells, a shift in Nrxn localization away from dendrites has been proposed to allow dendritic innervation [30]. In cortical neurons, however, we observe the opposite: Nrxn surface expression in dendrites increases with maturation. Dendritic Nrxns might modulate the function of postsynaptic Nrxn ligands, such as Nlgns, which control postsynaptic neurotransmitter receptor function [57], or leucine-rich repeat transmembrane neuronal protein 1 (LRRTM1), which shapes presynaptic properties [58]. At the Caenorhabditis elegans neuromuscular junction, the ectodomain of postsynaptic Nrxn is proteolytically cleaved and binds to the presynaptic α2δ calcium channel subunit to inhibit presynaptic release [59].

In conclusion, impaired trafficking of critical cargo proteins in the absence of SorCS1 and resulting defects in synaptic function might contribute to the pathophysiology of the neurodevelopmental [60–63] and neurodegenerative disorders [52,64] with which SORCS1 has been associated. These observations underscore the notion that intracellular sorting is a key contributor to the proper maintenance of synaptic protein composition and function.

Ethics statement

All animal procedures were approved by the Institutional Animal Care and Research Advisory Committee of the KU Leuven (ECD P015/2013 and ECD P214/2017) and were performed in accordance with the Animal Welfare Committee guidelines of the KU Leuven, Belgium. The health and welfare of the animals were supervised by a designated veterinarian. The KU Leuven animal facilities comply with all appropriate standards (cages, space per animal, temperature, light, humidity, food, water), and all cages are enriched with materials that allow the animals to exert their natural behaviour. Both males and females were used for all experiments. To the best of our knowledge, we are not aware of an influence of sex on the parameters analyzed in this study.

Animals

Wistar rats were obtained from Janvier Labs (Le Genest-Saint-Isle, France). CD-1 and C57BL/6J mice were obtained from the KU Leuven Mouse Facility. C57BL/6J Sorcs1^flox/flox mice were previously described [50] and kindly provided by Alan D. Attie (University of Wisconsin-Madison, USA). C57BL/6J Nrxn1α^HA and C57BL/6J Sorcs1^HA KI mice were generated by CRISPR/Cas9-mediated homology directed repair (HDR) targeting the mouse Nrxn1 locus at exon 2, and Sorcs1 locus at exon 1. Sorcs1^HA was commercially purchased from Cyagen (Santa Clara, CA), whereas Nrxn1α^HA was generated in-house at the Mutamouse core facility (KU Leuven/VIB). To generate Nrxn1α^HA KI, CRISPR/Cas9 components were microinjected in zygotes as ribonucleoproteins (RNPs) composed of: crRNA (guide RNA sequence: 5ʹ-TCCACTGGCCCTCGGCGCCC-3ʹ; IDT, Coralville, IA), tracrRNA (IDT, Coralville, IA, Cat #1072534), ssODN (oligo DNA donor sequence: 5ʹ-TGCTGTCTCCTCTGCCTGTCGCTGCTGCTGCTGGGCTGCTGGGCAGAGCTGGGCAGCGGGTACCCATACGACGTCCCAGATTACGCTCTGGAGTTTCCGGGCGCCGAGGGCCAGTGGACGCGCTTCCCCAAGTGGAACGCGTGCTGC-3ʹ; IDT, Coralville, IA) and Cas9 (IDT, Coralville, IA, Cat #1074182). To generate Sorcs1^HA KI, the donor DNA (5ʹ-GTCGGAGCCGCCGGGACATGCTAAAGGATGGAGGGCAGCAGGGGCTTGGGACTGGCGCATACCCATACGATGTTCCAGATTACGCTCGGGACCCGGACAAAGCCACCCGCTTCCGGATGGAGGAGCTGAGACTGACCAGCACCACA-3ʹ) and guide RNA (5ʹ-TGGGACTGGCGCACGGGACCCGG-3ʹ) were used. Insertion of the HA epitope tag was validated by sequencing, restriction digest (for Nrxn1α^HA), and western blot. To mitigate possible CRISPR/Cas9-mediated off-targets, Nrxn1α^HA and Sorcs1^HA mice were backcrossed to WT C57BL/6J. Nrxn1α^HA and C57BL/6J Sorcs1^HA mice are fertile and viable.

Cell lines

HEK293T-17 human embryonic kidney cells (available source material information: foetus) were obtained from American Type Culture Collection (ATCC, Manassas, VA, Cat #CRL-11268). HEK293T-17 cells were grown in DMEM (Thermo Fisher Scientific, Waltham, MA, Cat #11965092) supplemented with 10% (vol/vol) FBS (Thermo Fisher Scientific, Waltham, MA Cat, #10270106) and 1% (vol/vol) penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, Cat #15140122).

Neuronal cultures

Plasmids

Constructs were all generated using the Gibson Assembly Cloning Kit (New England Biolabs, Ipswich, MA, Cat #E5510S) by inserting the different DNA fragments (PCR-generated, gBlocks, or ultramers) in the final vectors digested with the respective restriction enzymes. pCAG-HA-Nrxn1α(-SS4) was kindly provided by Peter Scheiffele (University of Basel, Switzerland). For pFUGW-mCherry, pFUGW-Cre_T2A_mCherry, pFUGW-Cre_T2A_mCherry_T2A_Nrxn1α(-SS4) WT, pFUGW-Cre_T2A_mCherry_T2A_Nrxn1α(-SS4) Δ4.1, pFUGW-Cre-EGFP, pFUGW-Cre-EGFP_T2A_SorCS1^WT, pFUGW-Cre-EGFP_T2A_SorCS1^Y1132A, pFUGW-EGFP_T2A_HANrxn1α(-SS4), and pFUGW-EGFP_T2A_HA-Nrxn1α(-SS4)ΔN-terminal (remaining N terminal consists of HA epitope tag and 5 amino acids before the transmembrane region) PCR fragments were inserted into pFUGW vector digested with AgeI and EcoRI. For pcDNA3.1-HA-SorCS1cβ, a PCR fragment was inserted into pcDNA3.1(+) (Thermo Fisher Scientific, Waltham, MA, Cat #V79020) digested with EcoRI. For FCK(0.4)GW-Cre-EGFP a PCR fragment was inserted into FCK(0.4)GW vector digested with AgeI and EcoRI. For pIRESneo3-Str-KDEL_SBP-EGFP-Nrxn1α, a PCR fragment was inserted into pIRESneo3-Str-KDEL_SBP-EGFP-GPI (kindly provided by Franck Perez, Institute Curie, France; Addgene, Watertown, MA, plasmid #65294; RRID: Addgene_65294) digested with FseI and PacI. pcDNA4-SorCS1cβ-myc Y1132A, pcDNA3.1-HA-SorCS1cβ Y1132A and EGFP-tagged Rab7 T22N were generated by in vitro mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA, Cat #200522) from pcDNA4-SorCS1cβ-myc (kindly provided by Alan D. Attie, University of Wisconsin-Madison, USA), pcDNA3.1-HA-SorCS1cβ and EGFP-tagged Rab7 WT (kindly provided by Casper Hoogenraad, Utrecht University, The Netherlands), respectively. The following constructs were kindly provided: pIRESneo3-Str-KDEL_TfR-SBP-EGFP and EGFP-tagged TfR (Juan S. Bonifacino, National Institute of Health, USA); pEGFP-N3-Rip11 and pEGFP-C1-Rip11(490–653) (Rytis Prekeris, University of Colorado, USA); EGFP-tagged Rab11 WT, EGFP-tagged Rab11 S25N and EGFP-tagged Rab4 WT (Casper Hoogenraad, Utrecht University, The Netherlands); EGFP-tagged Rab5 WT and EGFP-tagged Rab5 S34N (Ragna Sannerud, KU Leuven, Belgium); EGFP-tagged Dynamin1 WT, EGFP-tagged Dynamin1 WT K44A [66] and pcDNA3-HA-Caspr2 (Catherine Faivre-Sarrailh, Aix-Marseille University, France); L315 control and L315 Nrxns TKD (Thomas C. Südhof, Stanford University, USA); FLAG-tagged Nlgn1 (Davide Comoletti, Rutgers University, USA); pEGFP-N1-NGL-3 (Eunjoon Kim, Korea Advanced Institute of Science and Technology, South Korea); and myc-tagged L1 [67] (Dan P. Felsenfeld, CHDI Foundation, USA). All DNA constructs used in this study were verified by sequencing. See S1 Table for a list of plasmids used in this study.

Neuron transfection

Rat cortical neurons (live-cell imaging experiments) and neurons from WT (cortical and hippocampal) and Sorcs1^flox/flox (cortical) mice were transfected at DIV6 to DIV8 using calcium phosphate, with the exception of the DIV3 live-cell imaging experiment, in which rat cortical neurons were transfected at DIV2. A total of 2 μg of DNA or 1 μg of DNA from each DNA construct (double co-transfections) were used per coverslip, with the exception of co-transfections of EGFP-tagged Rab proteins or Rip11 (WT and dominant negatives) with extracellular HA-tagged Nrxn1α, in which 0.75 μg and 1.25 μg of DNA was used for EGFP-tagged and HA-Nrxn1α DNA constructs, respectively. Briefly, DNA plasmids were diluted in Tris-EDTA buffer (10 mM Tris-HCl and 2.5 mM EDTA [pH 7.3]), followed by dropwise addition of CaCl₂ solution (2.5 M CaCl₂ in 10 mM HEPES [pH 7.2]) to the plasmid DNA-containing solution to give a final concentration of 250 mM CaCl₂. This solution was subsequently added to an equal volume of HEPES-buffered solution (274 mM NaCl, 10 mM KCl, 1.4 mM Na₂HPO₄, 42 mM HEPES [pH 7.2]) and vortexed gently for 3 s. This mixture, containing precipitated DNA, was then added dropwise to the coverslips in a 12-well plate, containing 250 μL of conditioned neuronal culture medium with kynurenic acid (2 mM), followed by 2 h incubation in a 37°C, 5% (vol/vol) CO₂/95% (vol/vol) air incubator. After 2 h, the transfection solution was removed, after which 1 mL of conditioned neuronal culture medium with kynurenic acid (2 mM) slightly acidified with HCl (approximately 5 mM final concentration) was added to each coverslip, and the plate was returned to a 37°C, 5% (vol/vol) CO₂/95% (vol/vol) air incubator for 20 min. Finally, coverslips were then transferred to the original dish containing the conditioned culture medium in the 37°C, 5% (vol/vol) CO₂/95% (vol/vol) air incubator to allow expression of the transfected constructs. Protein expression was typically for 24 h (live-cell imaging) or 48 h (immunocytochemistry).

Immunocytochemistry

Cells were fixed for 10 to 15 min in 4% (wt/vol) sucrose and 4% (wt/vol) paraformaldehyde in PBS (PBS: 137 mM NaCl, 2.7 mM KCl, 1.8 mM KH₂PO₄ and 10 mM Na₂HPO₄ [pH 7.4]) at room temperature and permeabilized with PBS + 0.25% (vol/vol) Triton X-100 for 5 min at 4°C. Neurons were then incubated in 10% (wt/vol) bovine serum albumin (BSA) in PBS for 1 h at room temperature to block nonspecific staining and incubated in appropriate primary antibodies diluted in 3% (wt/vol) BSA in PBS (overnight, 4°C). After washing 3 times in PBS, cells were incubated with the secondary antibodies diluted in 3% (wt/vol) BSA in PBS (1 h, room temperature). The coverslips were mounted using Prolong Gold Antifade mounting medium (Thermo Fisher Scientific, Waltham, MA, Cat #P36930).

In all immunocytochemistry experiments performed to determine the subcellular distribution of proteins of interest (Nrxns, SorCS1, Caspr2, L1) the axonal compartment was labeled using antibodies against Ankyrin-G, a marker of the AIS (NeuroMab, Davis, CA, Cat #73–146 or Santa Cruz Biotechnology, Dallas, TX, Cat #sc-31778), and the somatodendritic compartment was labeled using an anti-MAP2 antibody (Abcam, Cambridge, England, Cat #ab5392). See S2 Table for a list of antibodies used in this study.

Image analysis and quantification

All images obtained from immunocytochemistry experiments in fixed cells were captured on a Leica SP8 laser-scanning confocal microscope (Leica Micro-systems, Wetzlar, Germany). The same confocal acquisition settings were applied to all images taken from a single experiment. Parameters were adjusted so that the pixel intensities were below saturation. Fiji analysis software was used for quantitative imaging analysis. Z-stacked images were converted to maximal intensity projections and thresholded using constant settings per experiment.

Live-cell imaging

For live-cell imaging of fluorescently tagged Nrxn1α- and TfR-positive vesicles, neurons were transfected with a bicistronic expression plasmid encoding Streptavidin-KDEL and SBP-EGFP-Nrxn1α or Streptavidin-KDEL and TfR-SBP-EGFP, respectively, using the RUSH system [34]. After transfection, neurons were maintained in Neurobasal medium without B27 supplement, because the presence of D-biotin in B27 interferes with the RUSH system, or in Neurobasal medium supplemented with N-2 supplement (Thermo Fisher Scientific, Waltham, MA, Cat #P36930), which lacks D-biotin. Live-cell imaging was performed at room temperature (approximately 20°C) in imaging medium (119 mM NaCl, 5 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 30 mM glucose, and 10 mM Hepes [pH 7.4]). For long-term live-cell imaging experiments DIV8 to DIV10 or DIV3 rat cortical neurons, after 24 to 31 h or 25 to 29 h of protein expression, respectively, were imaged on a Nikon Eclipse Ti A1R confocal microscope (Minato, Japan). Images were collected with a 40× oil objective (1.3 NA; Nikon, Minato, Japan). Focal drift during the experiment was avoided by using the perfect focus system feature of the Nikon system. Laser intensities were kept as low as possible. Time lapses lasted for 2.5 h and frames were acquired as z-stacks every 5 min. Synchronous release of Nrxn1α or TfR was induced by application of 40 μM D-biotin (Sigma-Aldrich, St. Louis, MO, Cat #B4501) 10 min after the beginning of the imaging session. Protein synthesis was inhibited by including 20 μg/mL cycloheximide (Sigma-Aldrich, St. Louis, MO, Cat #C4859) in the imaging medium. For short-term live-cell imaging experiments, DIV8 to DIV10 rat cortical neurons expressing Streptavidin-KDEL and SBP-EGFP-Nrxn1α, 21 to 30 h after protein expression, were imaged on a Nikon spinning-disk confocal microscope equipped with a 60× oil objective (1.4 NA; Nikon). Time-lapses were performed by sequential capture of 200 ms images of SBP-EGFP-Nrxn1α every second for 60 to 120 s. Focal drift during the experiment was corrected automatically using the autofocus feature of the Nikon system. Neurons were imaged either for 20 to 34 min or 1 to 2 h after exposure to 40 μM D-biotin. In both experiments, a single image of live-stained pan-Neurofascin was taken at the beginning of every imaging session.

Biochemistry

LV production

Second generation VSV.G pseudotyped LVs were produced as described by Dittgen and colleagues and Kutner and colleagues [72,73]. HEK293T cells were transfected with control (mCherry) or Cre-T2A-mCherry-containing pFUGW vector plasmids and helper plasmids PAX2 and VSVG using Fugene6 (Promega, Madison, WI, Cat #E2691). Supernatant was collected 65 h after transfection and filtered through a 0.45 μm filter (Thermo Fisher Scientific, Waltham, MA, Cat #723–2545), aliquoted, and stored at −80°C.

Electrophysiology

Neurons were recorded on DIV14 to DIV16. The patch pipette solution contained (in mM): 136 KCl, 18 HEPES, 4 Na-ATP, 4.6 MgCl₂, 4 K₂-ATP, 15 Creatine Phosphate, 1 EGTA, and 50 U/ml Phospocreatine Kinase (300 mOsm [pH 7.30]). The external medium used contained the following components (in mM): 140 NaCl, 2.4 KCl, 4 CaCl₂, 4 MgCl₂, 10 HEPES, 10 Glucose (300 mOsm [pH 7.30]). Cells were whole-cell voltage clamped at −70 mV with a double EPC-10 amplifier (HEKA Elektronik, Lambrecht/Pfalz, Germany) under control of Patchmaster v2x32 software (HEKA Elektronik, Lambrecht/Pfalz, Germany). Currents were low-pass filtered at 3 kHz and stored at 20 kHz. Patch pipettes were pulled from borosilicate glass using a multistep puller (P-1000; Sutter Instruments, Novato, CA). Pipette resistance ranged from 3 to 5 MΩ. The series resistance was compensated to approximately 75%. Only cells with series resistances below 15 MΩ were included for analysis. All recordings were made at room temperature. Spontaneous glutamatergic release (sEPSC) was recorded at −70 mV. Evoked release was induced using brief depolarization of the cell soma (from 70 to 0 mV for 1 ms) to initiate action potential-dependent glutamatergic release (eEPSCs). A fast local multibarrel perfusion system (Warner SF-77B, Warner Instruments, Hamden, CT) was used to determine the RRP size using external recording solution containing 500 mM sucrose. A custom analysis procedure in Igor Pro (Wavemetrics Inc., Lake Oswego, OR) was used for offline analysis of evoked and sucrose responses. Spontaneous events were detected using Mini Analysis program (Synaptosoft, Fort Lee, NJ).

Statistical analysis

Results are shown as average or as average ± SEM, with n referring to the number of analyzed neurons for each group. For most experiments at least 3 independent cultures were included for analysis. Data sets were tested either using Mann-Whitney U test or Kruskal-Wallis test by Dunn’s multiple comparisons test. Statistical testing was performed using GraphPad Prism (GraphPad Software, San Diego, CA). In all instances, statistical significance was defined as follows: NS, not significant (p > 0.05); *p < 0.05; ** p < 0.01; *** p < 0.001.