Denatured human α-defensin attenuates the bactericidal activity and the stability against enzymatic digestion

doi:10.1016/j.bbrc.2007.04.132

Biochemical and Biophysical Research Communications

Volume 358, Issue 1, 22 June 2007, Pages 349-355

https://doi.org/10.1016/j.bbrc.2007.04.132 Get rights and content

Abstract

α-Defensin is an antimicrobial peptide which plays an important role in innate immunity. Human defensin (HD)-5 is stored in the Paneth cells of the small intestine as a pro-form and is cleaved by trypsin, which is co-secreted from the Paneth cell granules. The mature HD-5 is protected from further digestion by the proteolysis enzyme. We generated both recombinant HD-5 and proHD-5, and the reduced form of each peptide in order to determine their physiological roles of the disulfide bonds. The reduced proHD-5 attenuated the bactericidal activity and the stability against the trypsin digestion. Human defensin was protected from the enzymatic degradation by disulfide bridges. We further purified the HD-5 with a disulfide variation in the small intestine of Crohn’s disease patients. The HD-5 was sensitive to the trypsin treatment. These observations evidently predict that a defensin deficiency may be caused by a disulfide disorder in the disease.

Section snippets

Materials and methods

Generation of recombinant peptides and antibodies. The recombinant peptides were produced in Escherichia coli (E. coli) and then were purified as described [19]. The construct of the HD-5 specific sequences was kindly gifted by Ouellette AJ (University of California Irvine). The proHD-5 sequence was amplified from human small intestinal cDNA using primer sets (EcoRI-Met-proHD5-F: GAATTCATGGAGTCACTCCAGGAA and SalI-HD5-R: GTCGACTCATCAGCGACAGCAGAGTCT), and inserted in the pET28a vector (Novagen,

Recombinant peptide and the bactericidal activity

The purity of the peptides was assessed by AU–PAGE, in which the peptide migrates as each single band and the mobility depends on the size and the charge of the peptide. The HD-5 migrated faster than the proHD-5 since their numbers of amino acids are 32 and 75, respectively (Fig. 1A and B). The HD-5 was specifically reacted with the antiserum, checked by Western blotting (data not shown).

The antimicrobial activity, which was determined against S. typhimurium, demonstrated that both HD-5 and

Discussion

The epithelial cells are the first barrier against luminal bacteria and respond to many bacterial antigens. The small intestinal Paneth cells, which are specialized columnar cells characterized by dense granules, are one of the major contributors to the innate immunity [2], [21], [22]. Two enteric defensins, HD-5 and HD-6, have been found in the Paneth cells [7], [8]. The localization of HD-5 is determined by immunohistochemistry and its bactericidal activity has already been demonstrated [9].

References (25)

T. Ayabe et al.
The role of Paneth cells and their antimicrobial peptides in innate host defense
Trends Microbiol.
(2004)
C. Rumio et al.
Degranulation of paneth cells via toll-like receptor 9
Am. J. Pathol.
(2004)
T. Ayabe et al.
Activation of Paneth cell alpha-defensins in mouse small intestine
J. Biol. Chem.
(2002)
D.E. Jones et al.
Paneth cells of the human small intestine express an antimicrobial peptide gene
J. Biol. Chem.
(1992)
D.E. Jones et al.
Defensin-6 mRNA in human Paneth cells: implications for antimicrobial peptides in host defense of the human bowel
FEBS Lett.
(1993)
A. Maemoto et al.
Functional analysis of the alpha-defensin disulfide array in mouse cryptdin-4
J. Biol. Chem.
(2004)
J. Hampe et al.
Association between insertion mutation in NOD2 gene and Crohn’s disease in German and British populations
Lancet
(2001)
T. Ahmad et al.
The molecular classification of the clinical manifestations of Crohn’s disease
Gastroenterology
(2002)
S. Lala et al.
Crohn’s disease and the NOD2 gene: a role for paneth cells
Gastroenterology
(2003)
D.P. Satchell et al.
Interactions of mouse Paneth cell alpha-defensins and alpha-defensin precursors with membranes. Prosegment inhibition of peptide association with biomimetic membranes
J. Biol. Chem.
(2003)

A.J. Ouellette et al.

Purification and primary structure of murine cryptdin-1, a Paneth cell defensin

FEBS Lett.

(1992)

T. Ayabe et al.

Secretion of microbicidal alpha-defensins by intestinal Paneth cells in response to bacteria

Nat. Immunol.

(2000)

Cited by (42)

Antimicrobial peptide production in response to gut microbiota imbalance
2022, Peptides
Citation Excerpt :
Additionally, this antibacterial potential is usually associated with a lack of bactericidal activities on commensal bacteria, suggesting their role in gut microbiota homeostasis [121]. Nevertheless, some works have shown that HD-5 and HD-6 levels can be decreased in patients with ileal Crohn's disease [124]. In these cases, both α-defensins are susceptible to trypsin degradation, rendering them inactive against non-commensal bacteria [124].
The gut microbiota presents essential functions in the immune response. The gut epithelium acts as a protective barrier and, therefore, can produce several antimicrobial peptides (AMPs) that can act against pathogenic microorganisms, including bacteria. Several factors cause a disturbance in gut microbiota, including the exacerbated and erroneous use of antibiotics. Antibiotic therapy has been closely related to bacterial resistance and is also correlated with undesired side-effects to the host, including the eradication of commensal bacteria. Consequently, this results in gut microbiota imbalance and inflammatory bowel diseases (IBD) development. In this context, AMPs in the gut epithelium play a restructuring role for gut microbiota. Some naturally occurring AMPs are selective for pathogenic bacteria, thus preserving the health microbiota. Therefore, AMPs produced by the host’s epithelial cells represent effective molecules in treating gut bacterial infections. Bearing this in mind, this review focused on describing the importance of the host's AMPs in gut microbiota modulation and their role as anti-infective agents against pathogenic bacteria.
Host defense peptides as innate immunomodulators in the pathogenesis of colitis
2018, Antimicrobial Peptides in Gastrointestinal Diseases
Infectious colitis and inflammatory bowel diseases are common devastating diseases causing pain, diarrhea, and death. Innate immune defenses in the intestine, mostly contributed by host defense peptides, including cathelicidins and defensins, are still not fully understood. Of particular interest is to comprehend the function of cathelicidins and defensins in the pathogenesis of colitis and their contribution to intestinal host-microbial defenses. Aspects of the pathogenesis of infectious colitis studied in this chapter uncover roles of cathelicidins and defensins that promote epithelial defenses, regulate inflammatory responses, and mobilize leukocytes across the intestine for microbial elimination. This may decode how the innate system intends to quickly restore gut homeostasis and avoid damaging inflammation associated with pathogen persistence. Understanding these functions of host defense peptides in intestinal defenses facilitates developing therapeutic alternatives to control infectious diseases (e.g., enterocolitis) and mitigates inflammatory bowel diseases, such as Crohn's disease and ulcerative colitis.
Immune aspects of the pathogenesis of inflammatory bowel disease
2013, Pharmacology and Therapeutics
Citation Excerpt :
Tanabe et al. have reported that s–s binding of α-defensin stored in Paneth cells is important for escape from the degradation induced by protease activity. Interestingly, they also reported that some Crohn's disease patients have an abnormally denatured form of α-defensin that lacks s–s binding (Tanabe et al., 2007). As a novel function of defensins, Shi et al. found that MMP-7-deficient mice, which do not produce the mature form of α-defensin, are susceptible to DSS-induced colitis (Shi et al., 2007).
Although the precise etiologies of inflammatory bowel disease (IBD) (ulcerative colitis and Crohn's disease) remain obscure, several reports have indicated that dysfunction of the mucosal immune system plays an important role in its pathogenesis. Recent progress with genome-wide association studies has identified many IBD susceptibility genes. In individuals with genetic risk, abnormal interactions between the host immune system and gut flora, and dysregulation of cellular responses such as autophagy and ER stress, induce an abnormal host immune response in the gut resulting in intestinal inflammation. Research progress animal models in IBD, and in human IBD, has identified several key molecules in IBD pathogenesis such as TNFα and adhesion molecules, and molecular targeting therapies based on these molecules have been developed. Here, we review immunological aspects in IBD pathogenesis and the development of immunoregulatory therapy.
Alternative luminal activation mechanisms for paneth cell α-defensins
2012, Journal of Biological Chemistry
Paneth cell α-defensins mediate host defense and homeostasis at the intestinal mucosal surface. In mice, matrix metalloproteinase-7 (MMP7) converts inactive pro-α-defensins (proCrps) to bactericidal forms by proteolysis at specific proregion cleavage sites. MMP7(−/−) mice lack mature α-defensins in Paneth cells, accumulating unprocessed precursors for secretion. To test for activation of secreted pro-α-defensins by host and microbial proteinases in the absence of MMP7, we characterized colonic luminal α-defensins. Protein extracts of complete (organ plus luminal contents) ileum, cecum, and colon of MMP7-null and wild-type mice were analyzed by sequential gel permeation chromatography/acid-urea polyacrylamide gel analyses. Mature α-defensins were identified by N-terminal sequencing and mass spectrometry and characterized in bactericidal assays. Abundance of specific bacterial groups was measured by qPCR using group specific 16 S rDNA primers. Intact, native α-defensins, N-terminally truncated α-defensins, and α-defensin variants with novel N termini due to alternative processing were identified in MMP7(−/−) cecum and colon, and proteinases of host and microbial origin catalyzed proCrp4 activation in vitro. Although Paneth cell α-defensin deficiency is associated with ileal microbiota alterations, the cecal and colonic microbiota of MMP7(−/−) and wild-type mice were not significantly different. Thus, despite the absence of MMP7, mature α-defensins are abundant in MMP7(−/−) cecum and colon due to luminal proteolytic activation by alternative host and microbial proteinases. MMP7(−/−) mice only lack processed α-defensins in the small intestine, and the model is not appropriate for studying effects of α-defensin deficiency in cecal or colonic infection or disease.
Expression of plectasin in Pichia pastoris and its characterization as a new antimicrobial peptide against Staphyloccocus and Streptococcus
2011, Protein Expression and Purification
Citation Excerpt :
It has been reported that the oxidized form of HβD-3 (with SS bonds) is highly protected from in vitro degradation by trypsin compared to its reduced form [33]. Similarly, the oxidized form of HD-5 exhibited some level of stability against trypsin digestion, but its reduced form was sensitive to trypsin [34]. As shown in Fig. 7C, the antimicrobial activity of recombinant plectasin against S. aureus ATCC 25923 was decreased by trypsin treatment, which may be due to the reduced disulfides in purified plectasin.
Recombinant plectasin, the first fungus defensin, was expressed in Pichia pastoris and purified, and its physical, chemical and antimicrobial characteristics were studied. Following a 120 h induction of recombinant yeast, the amount of total secreted protein reached 748.63 μg/ml. The percentage of recombinant plectasin was estimated to be 71.79% of the total protein. After purification with a Sephadex G-25 column and RP-HPLC, the identity of plectasin was verified by MALDI-TOF MS. Plectasin exhibited strong antimicrobial activity against the Gram-positive bacteria Staphyloccocus aureus, Staphylococcus epidermidis, Streptococcus pneumoniae, and Streptococcus suis. At a concentration of 2560 μg/ml, this peptide showed approximately equal activity against S. aureus, S. epidermidis, S. suis, and S. pneumoniae, when compared to 320 μg/ml vancomycin, 640 μg/ml penicillin, 320 μg/ml vancomycin and 160 μg/ml vancomycin, respectively. In addition, plectasin showed anti-S. aureus activity over a wide pH range of 2.0 and 10.0, a high thermal stability at 100 °C for 1 h and remarkable resistance to papain and pepsin. The expression and characterization of recombinant plectasin in P. pastoris has potential to treat Streptococcus and Staphyloccocus infections when most traditional antibiotics show no effect on them. Our results indicate that plectasin can be produced in large quantities, and that it has pharmaceutical importance for the prevention and clinical treatment of Staphyloccocus and Streptococcus infections.
Characterization of recombinant plectasin: Solubility, antimicrobial activity and factors that affect its activity
2011, Process Biochemistry
Citation Excerpt :
The disulfide arrangement of Crp4 was shown to protect the peptide from degradation by matrix metalloproteinase-7 [7]. The disulfide bridges of human defensin contributed to the stability of the structure of the molecule and to maintenance of the activity [8]. Some results have suggested that the disulfide bonds of defensin play an important role in its antimicrobial activity.
Plectasin is the first known fungal defensin with potent activity against Gram-positive bacteria. To evaluate the potential therapeutic application of plectasin, we produced plectasin and investigated its solubility, activity and factors that affect its antimicrobial activity. Recombinant plectasin was produced from Escherichia coli in high yield by integration of fusion expression and on-column cleavage. Including 0.5 M arginine significantly increased the solubility of plectasin in acetic acid buffer with 10% glycerol from 89 μg/ml to 408 μg/ml. Plectasin was soluble at 846 μg/ml in Tris–glycerol–EDTA buffer. Plectasin was active against Gram-positive bacteria Streptococcus pneumoniae and Staphylococcus aureus with minimum inhibitory concentrations of 2 and 0.5 μg/ml. Much lower or no activity was observed toward Gram-negative bacteria and fungi. Plectasin (128 μg/ml) did not exhibit hemolytic activity toward rabbit erythrocytes. The activity of plectasin toward S. aureus was decreased by reduction with dithiothreitol, indicating that the disulfide-bond is essential for maximal activity. Plectasin was bactericidal under physiological concentrations of mono- and divalent cations. This activity was markedly attenuated by divalent cations in a concentration-dependent manner, however, with complete inhibition occurring at Ca²⁺ concentrations greater than 25 mM. These results suggested that the presence of the disulfide-bond and the absence of divalent cations play key roles in the antimicrobial activity of plectasin.

View all citing articles on Scopus

View full text

Denatured human α-defensin attenuates the bactericidal activity and the stability against enzymatic digestion

Abstract

Section snippets

Materials and methods

Recombinant peptide and the bactericidal activity

Discussion

Trends Microbiol.

Am. J. Pathol.

J. Biol. Chem.

J. Biol. Chem.

FEBS Lett.

J. Biol. Chem.

Lancet

Gastroenterology

Gastroenterology

J. Biol. Chem.

FEBS Lett.

Secretion of microbicidal alpha-defensins by intestinal Paneth cells in response to bacteria

Nat. Immunol.