Liver, Pancreas, and Biliary TractExpansion of Pdx1-expressing pancreatic epithelium and islet neogenesis in transgenic mice overexpressing transforming growth factor α☆,☆☆
Section snippets
Transgenic mouse breeding and tissue harvest
The MT-TGFα transgenic mouse line 1745-815 was propagated by crossing transgenic males with C57BL/6 × DBA females. Resulting litters were screened by polymerase chain reaction (PCR) analysis of genomic tail DNA. Transgenic offspring were identified by amplification of a 260–base pair PCR product using the primers GAGACAGTGGTCTGAAGATCC and ACAGGTTGTCTTCCAAACTGG.19 Transgenic mice of both sexes were studied at various ages after induction of TGF-α expression. Age-matched nontransgenic littermates
Ductal metaplasia develops progressively in MT-TGFα mice
As reported previously,14, 15 pancreatic tissue from MT-TGFα transgenic mice showed uniform pancreatic fibrosis and multiple foci of metaplastic ductal epithelium (Figure 1A–D).
Discussion
This study shows enhanced cellular proliferation and widespread activation of the Pdx1 homeobox gene within TGF-α–induced metaplastic ductal epithelium. In addition, this metaplastic epithelium exhibited a pluripotent differentiation capacity, as evidenced by the ability to generate both islet and ductal elements. Together, these findings suggest that TGF-α overexpression results in expansion of a metaplastic epithelium displaying features in common with the embryonic pancreas. These
Acknowledgements
The authors thank Dr. Graham Dockray for generously providing the rabbit anti–chromogranin A antibody and Dr. Randall Reed for generously providing rabbit anti-Pax6 antiserum; Drs. Roland Stein, Mark Magnuson, and Anna Means for helpful discussions; and Liying Yang for expert technical assistance.
References (37)
- et al.
Cell lineage analysis of pancreatic islet cell development: glucagon and insulin cells arise from catecholaminergic precursors present in the pancreatic duct
Dev Biol
(1987) - et al.
TGFα overexpression in transgenic mice induces liver neoplasia and abnormal development of the mammary gland and pancreas
Cell
(1990) - et al.
Overexpression of TGFα in transgenic mice: induction of epithelial hyperplasia, pancreatic metaplasia, and carcinoma of the breast
Cell
(1990) - et al.
Malignant transformation of duct-like cells originating from acini in transforming growth factor a transgenic mice
Gastroenterology
(1998) - et al.
Possible role of transforming growth factor α in the pathogenesis of Ménétrier's disease: supportive evidence from humans and transgenic mice
Gastroenterology
(1992) - et al.
Cytological changes in the pancreas of transgenic mice overexpressing transforming growth factor α
Gastroenterology
(1992) Developmental biology of the pancreas
Development
(1995)- et al.
The β cell transcription factors and development of the pancreas
J Mol Med
(1997) - et al.
Transcription factors contributing to the pancreatic β-cell phenotype
Horm Metab Res
(1997) Transcribing pancreas
Diabetes
(1998)
Insulin-promoter-factor 1 is required for pancreas development in mice
Nature
PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum
Development
Pancreatic agenesis attributable for a single nucleotide deletion in the human IPF1 gene coding sequence
Nat Genet
Expression of murine STF-1, a putative insulin gene transcription factor, in β cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny
Development
Hepatocyte nuclear factor 3beta is involved in pancreatic beta-cell–specific transcription of the pdx-1 gene
Mol Cell Biol
α-Cell neogenesis in an animal model of IDDM
Diabetes
Differentiation of new insulin-producing cells is induced by injury in adult pancreatic islets
Endocrinology
The homeodomain protein IDX-1 increases after an early burst of proliferation during pancreatic regeneration
Diabetes
Cited by (170)
Protein kinase D1 — A targetable mediator of pancreatic cancer development
2024, Biochimica et Biophysica Acta - Molecular Cell ResearchDuctal metaplasia in pancreas
2022, Biochimica et Biophysica Acta - Reviews on CancerCitation Excerpt :Acinar cells have high plasticity and serve as a source of islet regeneration [358–360] but remains controversial [344]. There are several lines of evidence supporting this notion of regenerating PDM into islets [25,70,123,345,361] and redirection of PDM to islet regeneration. However, the limitation of these studies is that the contribution of normal ductal cells, progenitor cell lineage, or residual acinar cells to islet regeneration cannot be excluded.
Acinar to ductal cell trans-differentiation: A prelude to dysplasia and pancreatic ductal adenocarcinoma
2022, Biochimica et Biophysica Acta - Reviews on CancerClinical significance of pancreatic ductal metaplasia
2022, Journal of Pathology
- ☆
Address requests for reprints to: Steven D. Leach, M.D., Division of Surgical Oncology, Vanderbilt University Medical Center, T-2104 Medical Center North, 21st and Garland Streets, Nashville, Tennessee 37232-2736. e-mail: [email protected]; fax: (615) 343-2030.
- ☆☆
Supported by National Institutes of Health (NIH) grant DK56211 (to S.D.L.), NIH grant DK42502 (to C.V.E.W.), Juvenile Diabetes Foundation Fellowship no. 397019 (to M.G.), NIH F32 CA79107 (to C.R.S.), NIH F32 CA76698 (to I.M.M.), NIH grant P30 AAR 41943 (core services), NIH grant CA68485 (Vanderbilt-Ingram Cancer Center), and a Department of Veterans Affairs Merit Review (to J.R.G.).