Forward and reverse primer sequences used for qRT-PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)Ensembl gene ID
eef1aGTGGCTGGAGACAGCAAGAAGAGATCTGACCAGGGTGGTTNM_131263
letm1CCACCTTCGAGACACAGTCCGGCCATCTCCAACTTCACTCNM_001045208
nampt1ACAACGGTCACCTTCCCATCACCAGGCAAGTCTCTACCCAXM_002661340
nampt2TGGCAAAGGCATGGATGTCTCACAGTCACCAGCATGTCCTNM_212668
period1bGTCGGATGATGACAAACAGCCCAGAGACACAGACGGACCTNM_212439
clock1aTCGGAAACTTTAAGTCCCTCAACACTCCCTCAAAGCCGTTTNM_130957
period2CCAACGTGGACGAAGATGTAGCAGCACCTTCTGGATGTCTNM_182857
β-actinTCACTCCCCTTGTTCACAATAAGGCAGCGATTTCCTCATCNM_131031
letm2CCAGTGCCCAAACTGGAGACTGAGGAGGACAGGGGATTXM_001339351
bmal1aTCCCAGAGCTCTGCAGATCTCCGTGTCCATGCTATCGTCAXM_005163022