Primers to amplify letm1 fragment ligated into pGEM-T easy vector

Primers letm1 coding sequence regionSequence
Forward primer letm1ATGGCATCGATTTTGCTCAC
Reverse primer letm1ACAGAGCCACCAGCTGCGGC