Table 1.

The CDR3 sequences of the enriched anti-SQSTM1 sdAb by in situ proximity ligation assay-seq.

#DNA sequence (5′-3′)Amino acid sequenceFrequency
1gagggtctggtttactggaccactaaaaagtcgtttggaggttgtttgttacatgattggtcaEGLVYWTTKKSFGGCLLHDWS49/260
2cgggccggggtttgtggagtcgtaggttcattttccatgtacacaatcgggaactgggtctatRAGVCGVVGSFSMYTIGNWVY32/260
3cgcgttcgcacttcccctcgcagtgcggtcgcagatgggagcgcataccgttcggagtctgccRVRTSPRSAVADGSAYRSESA26/260
4gcttacggcaatgacgtccagtccgtggccttcaagtatgttgtagggcgaggctaccagcttAYGNDVQSVAFKYVVGRGYQL21/260
5tatgatagggttggtggcggtcacgtgctgattgcctgctacagtgatgacctatgtatggggYDRVGGGHVLIACYSDDLCMG13/260
6ctattggtaattgactcatctgttatcgcccggttagacggccgtggtcgttctgatagattgLLVIDSSVIARLDGRGRSDRL13/260
7gcctatattgcgaagcggccatgctgcgattgccgggaggtccaatggggcagccgcacgtgcAYIAKRPCCDCREVQWGSRTC12/260
8gcgcgggtctttatgccatgtactccttcgcacattatcggtgcaatgtgtacattggcatgcARVFMPCTPSHIIGAMCTLAC12/260
9gatcgggggtgtcatagtacgttggggtcgcggatatcctttttcaaaggctgtataatcgggDRGCHSTLGSRISFFKGCIIG11/260
10gttttacatgtcctttcttgggatcggtgtgagtacgaccccgctcacgacttgcgcacggctVLHVLSWDRCEYDPAHDLRTA10/260
11gcgcgtgcgcacttcgcctcgctctgcgactgtcaaggcaaccgcataacgctcttatgcgacARAHFASLCDCQGNRITLLCD9/260
12gatcaagttcgtgaccattcatggtgcaacctatttaggacattaagagtatgcgtgttaattDQVRDHSWCNLFRTLRVCVLI9/260
13cgggaaccatttgctcggtatctaagaaaagagtcataccctctttttcgaatgtacagtttcREPFARYLRKESYPLFRMYSF8/260
14gggggcaacaccgtgaaggtgtccaacattttcgaagtatcgtcgtctgtgcgcgttcgtttgGGNTVKVSNIFEVSSSVRVRL6/260
15cttcgatggagctggttcccaagcggatcaacagcgaatctatctctggggataggctgtacgLRWSWFPSGSTANLSLGIGCT6/260
16aacatggccattagggtcaggtgggtggcaatgtttacgtgcggcccgatcggaggggtaggtNMAIRVRWVAMFTCGPIGGVG5/260
17gcggtggaaagttgtgacgggtttcgtacaggtcggactgttccgtatcgagaggtaacgtacAVESCDGFRTGRTVPYREVTY3/260
18ggcattgggtatgccggcgactgccgtgctcatacaattgctacgcgtaggttcagcgttggaGIGYAGDCRAHTIATRRFSVG3/260
19agacaggcgccgttcggatcgagatgctcaatcagctcttcacctaagggacgttatccaagcRQAPFGSRCSISSSPKGRYPS2/260
20ccaggtcacggccggccatggcgtgcggccacgtttccagtggatgaaggtggcggttcagccPGHGRPWRAATFPVDEGGGSA2/260
21gacctttgggctccgttgatggtgtgctctggcggtcttacccagatgttatcgaatagtgatDLWAPLMVCSGGLTQMLSNSD2/260
22gcatgcgaactagatgctgttaggctttggccggactttgtgagacctgctgtattttctatcACELDAVRLWPDFVRPAVFSI1/260
23cggcgcggttttgtccgacacacaaaaatcaagttacttgattatgcgttaactgaagtgagaRRGFVRHTKIKLLDYALTEVR1/260
24gtaagaacgccggtcattctcagatgttttcaatccggtattttttatttagtcggtgaagttVRTPVILRCFQSGIFYLVGEV1/260
25cctggtgatggtcaagaggttatatttgccttcgttcaacgctcgacccgtgcgtggcccgtcPGDGQEVIFAFVQRSTRAWPV1/260
26tttccgtcacgtctgaagtgtacgcgcggatgtggttgcagaacgtttaactttcccgccctcFPSRLKCTRGCGCRTFNFPAL1/260
27ataattgcagaactttgttcagggctgccgtgtacttctttcttgaggactccttgtcctgtcIIAELCSGLPCTSFLRTPCPV1/260