Table 3.

4C primer sequences for inverse PCR.

NameSequence 5′-3′
Promoter viewpointfwd: TACACGACGCTCTTCCGATCTAGCAGAGAGGAGTTGAGG
rev: ACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGTGAACCAGGTGCCAG
Intronic viewpointfwd: TACACGACGCTCTTCCGATCTATGTGTGCGTTCATGTATGT
rev: ACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAGGAAAGGTTAGGAAGTGG