Table 1.

qPCR primers for the quantification of gene expression.

NameSequence 5′-3′
ZBTB16fwd: AGAGGGAGCTGTTCAGCAAG
rev: TCGTTATCAGGAAGCTCGAC
FKBP5fwd: TGAAGGGTTAGCGGAGCAC
rev: CTTGGCACCTTCATCAGTAGTC
RPL19fwd: ATGTATCACAGCCTGTACCTG
rev: TTCTTGGTCTCTTCCTCCTTG
GILZfwd: CCATGGACATCTTCAACAGC
rev: TTGGCTCAATCTCTCCCATC