Table 1.

Sequences of synthetic guide RNA (sgRNA) targeting KrasG12D.

sgRNAsgRNA sequence (5′ to 3′)
sgRNA1 KrasG12D forwardCACCGGTGGTTGGAGCTGATGGCGT
sgRNA1 KrasG12D reverseAAACACGCCATCAGCTCCAACCACC
sgRNA2 KrasG12D forwardCACCGCTTGTGGTGGTTGGAGCTGA
sgRNA2 KrasG12D reverseAAACTCAGCTCCAACCACCACAAGC