Table 2.

List of primer sequences used.

PrimerSequence (5′-3′)
Ccl11 forwardCACGGTCACTTCCTTCACCT
Ccl11 reverseTGGGGATCTTCTTACTGGTCA
Clca1 forwardCTGTCTTCCTCTTGATCCTCCA
Clca1 reverseCGTGGTCTATGGCGATGACG
Foxa3 forwardGCTGACCCTGAGTGAAATCTAC
Foxa3 reverseACGAAGCAGTCATTGAAGGAC
Il4 forwardGAGAGATCATCGGCATTTTGA
Il4 reverseTCTGTGGTGTTCTTCGTTGC
Il5 forwardACATTGACCGCCAAAAAGAG
Il5 reverseCACCATGGAGCAGCTCAG
Il13 forwardCCTCTGACCCTTAAGGAGCTTAT
Il13 reverseCGTTGCACAGGGGAGTCT
Il33 forwardTCCAACTCCAAGATTTCCCCG
Il33 reverseCATGCAGTAGACATGGCAGAA
Muc5ac forwardGCATCAATCAACAGCGAAACTT
Muc5ac reverseCGAGTCACCCCCTGAGTC
Nb-actin forwardGCATCCCGTGCTGCTGAC
Nb-actin reverseGGCGTACAGCGACAACACTG
Retnla forwardTATGAACAGATGGGCCTCCT
Retnla reverseGGCAGTTGCAAGTATCTCCAC
Rpl13a forwardCATGAGGTCGGGTGGAAGTA
Rpl13a reverseGCCTGTTTCCGTAACCTCAA