Primer sequences used for qRT-PCR

Gene nameForward sequenceReverse sequence
HSPD1AAGGAAGGCTTCGAGAAGATTAGGGTCACAGGTTTAGACTGCTT
HSPH1GCACAGATTGTTGGCCTAAACCCACTATCCGAGGTTTCTCATC
HSP90AA1CTTGACCAATGACTGGGAAGATCACGTCGTGGGACAAATAGAA
HSF1AGCAGCTCCTTGAGAACATCTGTCCTGGCGGATCTTTATG
TFF1CCCTCCCAGTGTGCAAATAAGGGAGGGACGTCGATGGTATTA
GREB1CCCATCTTTTCCCAGCTGTAATTTGTTTCCAGCCCTCCTT
PGRAGGTCTACCCGCCCTATCTCCAAATCTTCTGAGGTAATGACTCG
ESR1CCAGGGAAGCTACTGTTTGCTGATGTAGCCAGCAGCATGT
CCNG2GAACCTCCACAACAGCTACTATTCACAAGAGTCCTCACTTTCAC
MMDGCAGCTGGAGGAACCATTTAGGAGAGAATCCCATTGTGAGATAG
SMAD6CTGTCCGATTCCACATTGTCTCATGCTGGCGTCTGAGAAT
ACTBCGCGAGAAGATGACCCAGATAGAGGCGTACAGGGATAGCA
ERCC controlGGTCTGCTGACAAAGCATGATCGCCCCAGTAGTTTCTGTT