Primer sequences used for ChIP-qPCR

RegionForward sequenceReverse sequence
HSPD1 (promoter)TACGGCTCAAGGGTCAAATCAAGGAGCTGTTTCTAGGCTTT
HSPH1 (promoter)CAGCCTTATGTATCGCACTGAAGAAGAAGGAAGCGGAAGTG
HSP90AA1 (promoter)CTAAGTGACCGCACAGGACCCGTCGCTATATAAGGCA
TFF1 (promoter)CCGAGTCAGGGATGAGAGGGGCCTCCTTAGGCAAATGTT
GREB1 (enhancer)GAGCTGACCTTGTGGTAGGCCAGGGGCTGACAACTGAAAT
ESR1 (enhancer)CTGCAGTAGGCACTCAGTAAATTCAAACTAACCTGAAACTCGGT
Control region #1ATGTCAGGCCCATGAACGATGCATTCATGGAGTCCAGGCTTT
Control region #2AGGACCTGCAGCAAACAGAATGTCTACATGGGCTAGTGTGCT