Genotyping was performed using the following primers, with the expected size of PCR products are indicated in the table below:

PrimersSequenceExpected PCR size (bp)
c-Jun lox5 (For)CTCATACCAGTTCGCACAGGC
c-Jun lox6 (Rev 1)CGCTAGCACTCACGTTGGTAG350
c-Jun flox2 (Rev 2)CAGGGCGTTGTGTCACTGAGCT4,000/600
Cre internal Ctrl (For)CTAGGCCACAGAATTGAAAGATCT324
Cre internal Ctrl (Rev)GTAGGTGGAAATTCTAGCATCATCC
Cre transgene (For)TCCAATTTACTGACCGTACACCAA500
Cre transgene (Rev)CCTGATCCTGGCAATTTCGGCTA