Table 5.

Oligonucleotide sequences.

AmpliconForward (5′-3′)Reverse (5′-3′)
18sTCAGCCACCCGAGATTGAGCGTGCAGCCCCGGACATCTAA
GapdhGGTGCTGAGTATGTCGTGGAGGCGGAGATGATGACCCTTT
XistGCTTGAACTACTGCTCCTCCGGGCAATCCTTCTTCTTGAGGCA
Nlrp6 1a-1fATCCTGAATGCCCAGCGGTGCCCTCATTCTGGGTGTGAGGGTGT
Nlrp6 1a-1dCGTGCATCAGACGCTCTCTAGGCAGGAAGGAATTTGAGGC
Nlrp6 exon 1e-1fCTGGAACTGGACTTACGGGTGGGCAGAAGGTTGGAGAGAT
Nlrp6 exon 5-6GTGAGACAATGACTACCCCGAAATGTCTCGGCAAACTGCATCAG
BC024386 exon 1CGTGCATCAGACGCTCTCTA
BC024386 exon 1-2TCGCACTCACTAAGCCATGG
BC024386 exon 1-intron 1TGCCATTGTTTTGCAGATTTGG
BC024386 exon 1-intron 2-exon 3 (hnRNA)GCTTGGACACGCACAGAATCCCACTTCCTCAGCCCTGTATG
Nlrp1bGACTTTGTGGCTTGTTGAATGCATTTAGCTGCAGGTCTAGCTCTCT
Nlrp2CCCTGCAAATGCTTAGATTGAAGGTCACTGCTGATTCTCAGTTG
Nlrp3AGAGCCTACAGTTGGGTGAAATGCCACGCCTACCAGGAAATCTC
Nlrp4aTTGCTGCCCACTGCTTAAAACCAGCCTTTCCATATAGCTGTGTTC
Nlrp5GGCCAAAAATAGAGTGGGAGTAAAAGGCCACAGTTGTCCAGTATCAAC
Nlrp9aGTTATGGTTGCCTGGTTGCTATTTTTATTGTTGCCAAGTTTCAGGGTCTTT
Nlrp10AACAGGGTCTCAGGCAGTCAAGATCCACACCTGGGAGATGCA
Nlrp12AGCGTGGTATATCCCTCGAAGACCCTGAGCATCATGGAAAGAA
Nlrp14GAGAGACTGGCCTTAGCAAGCTACAAGCATAAATGTGTCAGCCTCTT
AIM2ATCTAGGCTGATCCTGGGACTGTGTCCAGGCCGGTCAACAAC