Table 1.

Primers used in this study.

Gene targetForward primer sequenceReverse primer sequence
qPCR
Defa (global)GGTGATCATCAGACCCCAGCATCAGTAAGAGACTAAAACTGAGGAGCAGC
Lyz1GAGACCGAAGCACCGACTATGCGGTTTTGACATTGTGTTCGC
Lgr5ACCTGTGGCTAGATGACAATGCTCCAAAGGCGTAGTCTGCTAT
Olfm4CAGCCACTTTCCAATTTCACTGGCTGGACATACTCCTTCACCTTA
Ascl2CCGTGAAGGTGCAAACGTCCCCTGCTACGAGTTCTGGTG
Bmi1ATCCCCACTTAATGTGTGTCCTCTTGCTGGTCTCCAAGTAACG
Wnt1CGAAGGCTCCATCGAGTCCGCATCTCAGAGAACACGGTCG
Wnt2TCGCTGGAACTGCAACACCAGCAGGACTTTAATTCTCCTTGG
Wnt2bAATTGCACCACACTGGACCGCGAGTGATAGCGTGGACCA
Wnt3GATGCCCGCTCAGCTATGAACGGAGGCACTGTCGTACTTG
Wnt3aCTCCTCTCGGATACCTCTTAGTGGCATGATCTCCACGTAGTTCCTG
Wnt4AGGATGCTCGGACAACATCGCGCATGTGTGTCAAGATGGC
Wnt5aAGCCTGTAAGTGTCATGGAGTCGCGGCGCTATCATACTTCT
Wnt5bAGATAGGTAGCCGAGAGACTGCGGTAGCCGTACTCCACGTTG
Wnt6ACGAGCGGATCTCCTCTACGCGGCACAGACAGTTCTCCT
Wnt7aCCTGGACGAGTGTCAGTTTCACCCGACTCCCCACTTTGAG
Wnt7bATCGACTTTTCTCGTCGCTTTCGTGACACTTACATTCCAGCTTC
Wnt8aCTCCAGACTCTTCGTGGACAGACACTTGCAGGTCCTTTTCGT
Wnt8bGAATTGCCCCGAGAGAGCTTTGAAGCCCACGTTGTCACTG
Wnt9aACACCTGGACGACTCTCCCCTTGTCACCACACGACTCTGT
Wnt9bGGGTGTGTGTGGTGACAATCTGGCACTTGCAGGTTGTTCTC
Wnt10aCCTGAACACCCGGCCATACTTGTGGAGTCTCATTCGAGCA
Wnt10bGAAGGGTAGTGGTGAGCAAGAGGTTACAGCCACCCCATTCC
Wnt11TCATGGGGGCCAAGTTTTCCTTCCAGGGAGGCACGTAGAG
Wnt16AGAGTGCAACCGGACATCAGCGTAGCAGCACCAGATAAACTT
GapdhAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA
Genotyping
 Defa-Cre alleleGCACGTTCACCGGCATCAACCGATGCAACGAGTGATGAGGTTC
 Wnt3 floxed alleleTTCTTAGATGGGCTTGTGATGTCTGGCTTCAGCATCTGTTACCTTC