Table 1.

siRNA and primer sequences.

siRNAs
 PSMB8CCACUCACAGAGACAGCUAUU
 IRF1GAAAGUUGGCCUUCCACGUCU
 PSMB5AAGCUCAUAGAUUCGACAUUG
 Non-targeted negative controlUUCUCCGAACGUGUCACGUTT
Primers
 PSMB6CAAGCTGACACCTATTCACGACCGGTATCGGTAACACATCTCCT
 PSMB7ATCGCTGGGGTGGTCTATAAGAAGAAATGAGCTGGTTGTCAT
 FOXO3TCTTCAGGTCCTCCTGTTCCTGGGAAGCACCAAAGAAGAGAGAAG
 NOXAAGAGCTGGAAGTCGAGTGTGCACCTTCACATTCCTCTC
 BIMGTATTCGGTTCGCTGCGTTCGCGTTTCTCAGTCCGAGAGT
 CASP3TGCTATTGTGAGGCGGTTGTTCACGGCCTGGGATTTCAAG
 CASP 7GTGGGAACGATGGCAGATGAGAGGGACGGTACAAACGAGG
 BCL2GTGAAGTCAACATGCCTGCCACAGCCTGCAGCTTTGTTTC
 NFKBCGCGCCGCTTAGGAGGGAGAGGGCCATCTGCTGTTGGCAGT
 PSMB5CCGCGCTCTACCTTACCTACCTGCATGGCTTAATCTTTGAGACAAG
 PSMB8CGTCACCAACTGGGACGACACTTCTCGCGGTTGGCCTTGG
 IRF1AGCTCAGCTGTGCGAGTGTATAGCTGCTGTGGTCATCAGG
 STAT1CGGGCTCCTTCTTCGGATTCCAGAGGTAGACAGCACCACC
 XBP1TCCTGTTGGGCATTCTGGACGGCTGGTAAGGAACTGGGTC
 TAP1TAGTCTGGGCAGGCCACTTTCTCGGAAAGTCCCAGGAACA
 TAP2AGTGCTGGTGATTGCTCACAGAACCAGGCGGGAATAGAGG
 ATF4CTTGATGTCCCCCTTCGACCGAAGGCATCCTCCTTGCTGT