Primer sequences.

Primer sequence
 Mouse
H3_FGTGAAGAAACCTCATCGTTACAGGCCTGGT
H3_RCTGCAAAGCACCAATAGCTGCACTCTGGAA
Rplp0_FTTCATTGTGGGAGCAGAC
Rplp0_RCAGCAGTTTCTCCAGAGC
BiP (Hspa5)_FTTCAGCCAATTATCAGCAAACTCT
BiP (Hspa5)_RTTTTCTGATGTATCCTCTTCACCAGT
Edem_FCTACCTGCGAAGAGGCCG
Edem_RGTTCATGAGCTGCCCACTGA
β-actin_FGGCTGTATTCCCCTCCATCG
β-actin_RCCAGTTGGTAACAATGCCATGT
 Human
BiP_FTCCTATGTCGCCTTCACT
BiP_RACAGACGGGTCATTCCAC
GAPDH_FCCAGGTGGTCTCCTCTGACTT
GAPDH_RGTTGCTGTAGCCAAATTCGTTGT
DNAJB1_FGACCCTCATGCCATGTTTGC
DNAJB1_RCCCATAGGGAAGCCAGAGAAT
DNAJC12_FGAATGTCACCCAGACAAGC
DNAJC12_RGAATGGCATCGACATCTG