Individual gene names with corresponding forward and reverse primer sequences for RT-qPCR. Sequences are all expressed 5′ –> 3′

GeneForward primer sequenceReverse primer sequence
GapdhGCCTTCCGTGTTCCTACCCCTGCTTCACCACCTTCTT
Myh7CTCAAGCTGCTCAGCAATCTAGACACGGTCTGAAAGGATGAG
Myh6GGATATTGATGACCTGGAGCTGAGCCATCTCCTCTGTTAGGT
Actc1AGCCCTCTTTCATTGGTATGGCCTCCAGATAGGACATTGTTGG
Myl2AGAAAGCCAAGAAGCGATAGCTCTGTTCTGGTCCATGATTGT
Myl3GGGCGAGATGAAGATCACATACTGGAATTGAGCTCTTCCTGTTT
Myl4AACCCAAGCCTGAAGAGATGTCCACGAAGTCCTCATAGGT
Myl7CGTGGCTCTTCTAATGTCTTCTCAGATGATCCCATCCCTGTTC
Tnnt1GCCCTTGAACATCGACTACATCAACTTCTCCATCAGGTCAAA
Tnnt2GGAGAGAGAGTGGACTTTGATGCTTCCTCCTTCTTCCTGTTCTC
NppaTTTGGCTTCCAGGCCATATTCATCTTCTACCGGCATCTTCTC
NppbACTCCTATCCTCTGGGAAGTCGCTGTCTCTGGGCCATTT
Mylk3GAATTCCAAGGTGGCTGATTTCTCAGTACATGGTTTGGCTTCA