DNA substrates used in study.

SubstrateOligo No.Sequence (5′–3′)Figure
5′-overhang5′-FAM_42GACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGFigs 1C and E, 2C and E, and S1E
sAS13CAAAGATGTCCTAGCAAGGC
Competitor to 5′-overhang (helicase assay)sAS14GCCTTGCTAGGACATCTTTGFigs 1E and 2E
ssDNA5′-FAM_XO1GACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCCFigs 1D, 2D, and S1E
double-stranded DNA5′-FAM_XO1GACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCCFig S1E
XO1cGGGTGAACCTGCAGGTGGGCAAAGATGTCCTAGCAAGGCACTGGTAGAATTCGGCAGCGTC
Y-structure5′-FAM_42GACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGFig S1E
sAS36CAAAGATGTCCTAGCAAGGCTTTTTTTTTTTTTTTTTTTTTT
3′-overhang5′-FAM_42GACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGFig S1E
sAS38TGGTAGAATTCGGCAGCGTC
Primer template5′-FAM_sAS50GGGTGAACCTGCAGGTGGFig 4B and C
XO1GACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCC
DNA blocksAS51_3′-biotinTGTCCTAGCAAGGCA
Competitor (primer extension assay)XO1cGGGTGAACCTGCAGGTGGGCAAAGATGTCCTAGCAAGGCACTGGTAGAATTCGGCAGCGTC