Table 1.

Primers used in qPCR and TAF-ChIP library preparation.

Mapk distal FwdATCGGGACCTTAAGCCAAGT
Mapk distal RevAAACGCTTTTACTGCTGATGG
Dock FwdGCTCCGGCAAAATCATTAAA
Dock RevCGCGATTGAAAAACACACAA
Dab FwdCCCCACAACGCCTTAAAGTA
Dab RevTTTGCGTCTTCCGTCTCTTT
Rca1 FwdGGTCACACTGATCCGTACCC
Rca1 RevCTCCAACTCGAAGGATGACC
Primer-Neg FwdCCATTAATCGAGGGCTGAAA
Primer-Neg RevTTGGGGCATAAACAGAGGAC
fw ATAC-seq primer, general, no indexAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGT*G
rev ATAC-seq primer, Truseq, index 34 CATGGCCAAGCAGAAGACGGCATACGAGATGCCATGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 48 TCGGCACAAGCAGAAGACGGCATACGAGATTGCCGAGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 22 CGTACGCAAGCAGAAGACGGCATACGAGATCGTACGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 15 ATGTCACAAGCAGAAGACGGCATACGAGATTGACATGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 46 TCCCGACAAGCAGAAGACGGCATACGAGATTCGGGAGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 45 TCATTCCAAGCAGAAGACGGCATACGAGATGAATGAGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 40 CTCAGACAAGCAGAAGACGGCATACGAGATTCTGAGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 39 CTATACCAAGCAGAAGACGGCATACGAGATGTATAGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 38 CTAGCTCAAGCAGAAGACGGCATACGAGATAGCTAGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 37 CGGAATCAAGCAGAAGACGGCATACGAGATATTCCGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 36 CCAACACAAGCAGAAGACGGCATACGAGATTGTTGGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 35 CATTTTCAAGCAGAAGACGGCATACGAGATAAAATGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 25 ACTGATCAAGCAGAAGACGGCATACGAGATATCAGTGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 26 ATGAGCCAAGCAGAAGACGGCATACGAGATGCTCATGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 27 ATTCCTCAAGCAGAAGACGGCATACGAGATAGGAATGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 28 CAAAAGCAAGCAGAAGACGGCATACGAGATCTTTTGGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 23 GAGTGGCAAGCAGAAGACGGCATACGAGATCCACTCGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 24 GGTAGCCAAGCAGAAGACGGCATACGAGATGCTACCGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 42 TAATCGCAAGCAGAAGACGGCATACGAGATCGATTAGTCTCGTGGGCTCGGAGATG*T
rev ATAC-seq primer, Truseq index, 41 GACGACCAAGCAGAAGACGGCATACGAGATGTCGTCGTCTCGTGGGCTCGGAGATG*T