Table 1.

Primer sequences for qPCR.

Gene symbolGene nameForward sequence (5′-3′)Reverse sequence (5′-3′)
Human primers
ATG4DAutophagy related 4D cysteine peptidaseCTCAACCCCGTGTATGTGCTACAGTGAGTGTCGCGGTTT
ATG9BAutophagy related 9BGCTACTGGGACATCCAGGTGAAGAGGCGGGACTGCAC
CATCatalaseACTTTGAGGTCACACATGACATTCTGAACCCGATTCTCCAGCA
FIS1Mitochondrial fission 1 proteinTGACATCCGTAAAGGCATCGCTTCTCGTATTCCTTGAGCCG
GPXGlutathione peroxidase 1CCAGTCGGTGTATGCCTTCTCGAGGGACGCCACATTCTCG
HMOX1Heme oxygenase 1GCCAGCAACAAAGTGCAAGGAGTGTAAGGACCCATCGGA
HPRT1Hypoxanthine phosphoribosyltransferase 1CCTGGCGTCGTGATTAGTGATAGACGTTCAGTCCTGTCCATAA
LAMP1Lysosomal-associated membrane protein 1ACGTTACAGCGTCCAGCTCATTCTTTGGAGCTCGCATTGG
MAP1LC3BMicrotubule associated protein 1 light chain 3 betaGAGAAGACCTTCAAGCAGCGTATCACCGGGATTTTGGTTG
MCOLN1Mucolipin 1TTGCTCTCTGCCAGCGGTACTAGCAGTCAGTAACCACCATCGGA
MFN2Mitofusin 2ATGTGGCCCAACTCTAAGTGCACAAACACATCAGCATCCAG
PPARGC1APeroxisome proliferator-activated receptor gamma, coactivator 1 alphaAGCCTCTTTGCCCAGATCTTCTGATTGGTCACTGCACCAC
PPARGC1BPeroxisome proliferator-activated receptor gamma, coactivator 1 betaCCACATCCTACCCAACATCAAGCACAAGGCCGTTGACTTTTAGA
POLGDNA polymerase gamma, catalytic subunitGAAGGACATTCGTGAGAACTTCCGTGGGGACACCTCTCCAAG
PPIAPeptidylprolyl isomerase ACAGACAAGGTCCCAAAGACAGTTGCCATCCAACCACTCAGTC
PRCPPARG related coactivator 1 (PPRC1)GTGGTTGGGGAAGTCGAAGTGACAAAGCCAGAATCACCC
SOD1Superoxide dismutase 1, solubleAGGGCATCATCAATTTCGAGCGCCCACCGTGTTTTCTGGA
SOD2Superoxide dismutase 2, mitochondrialCAGACCTGCCTTACGACTATGGCGTTCAGGTTGTTCACGTAGG
SIRT1Sirtuin 1TCAGTGTCATGGTTCCTTTGCAATCTGCTCCTTTGCCACTCT
SIRT3Sirtuin 3TGGAAAGCCTAGTGGAGCTTCTGGGTGGGGGCAGCCATCATCCTATTTGT
TFAMTranscription factor a, mitochondrialCCATATTTAAAGCTCAGAACCCAGCTCCGCCCTATAAGCATCTTG
TP53Tumor protein p53TCAACAAGATGTTTTGCCAACTGATGTGCTGTGACTGCTTGTAGATG
TXN2Thioredoxin 2TGATGACCACACAGACCTCGATCCTTGATGCCCACAAACT
TWIST1Twist family BHLH transcription factor 1CGGAGAAGCTGAGCAAGATTTGGAGGACCTGGTAGAGGAA
VIMVimentinGAGAACTTTGCCGTTGAAGCTCCAGCAGCTTCCTGTAGGT-3
WIPI1WD repeat domain, phosphoinositide interacting 1CCTCCTGGATATTCCTGCAAGCACAATCTCCCCTGAAGTC
ZEB1Zinc finger E-box binding homeobox 1AGTGATCCAGCCAAATGGAATTTTTGGGCGGTGTAGAATC
ZEB2Zinc finger E-box binding homeobox 2AACAAGCCAATCCCAGGAGGTTGGCAATACCGTCATCCT
Mouse primers
Hprt1Hypoxanthine phosphoribosyltransferase 1TCAGTCAACGGGGGACATAAAGGGGCTGTACTGCTTAACCAG
Ppargc1aPeroxisome proliferator-activated receptor gamma, coactivator 1 alphaAGCCGTGACCACTGACAACGAGGTCGCATGGTTCTGAGTGCTAAG
Ppargc1bPeroxisome proliferator-activated receptor gamma, coactivator 1 betaCCCAGCGTCTGACGTGGACGAGCCCTTCAGAGCGTCAGAGCTTGCTG
PpiaPeptidylprolyl isomerase AGAGCTGTTTGCAGACAAAGTTCCCCTGGCACATGAATCCTGG