Table 1.

Primer sequences for SDM of luciferase reporter constructs and HDR templates.

NameSequence 5′ to 3′
GILZ wt GBS to FKBP5-2CAGGACCAAAGGAGAACATCCTGTGCCACCACATATAC
GTATATGTGGTGGCACAGGATGTTCTCCTTTGGTCCTG
GILZ wt GBS to PALCAGGACCAAAGGAGAACAAAATGTTCTACCACATATAC
GTATATGTGGTAGAACATTTTGTTCTCCTTTGGTCCTG
IL1R2 intro CGT GBSTACTCAGACCCAGCAGAACATTTTGTACGTGCTCCCCGTGAG
CTCACGGGGAGCACGTACAAAATGTTCTGCTGGGTCTGAGTA
IL1R2 intro PAL GBSTACTCAGACCCAGCAGAACAAAATGTTCTTGCTCCCCGTGAG
CTCACGGGGAGCAAGAACATTTTGTTCTGCTGGGTCTGAGTA
IL1R2 intro FKBP5-2 GBSTACTCAGACCCAGCAGAACATCCTGTGCCTGCTCCCCGTGAG
CTCACGGGGAGCAGGCACAGGATGTTCTGCTGGGTCTGAGTA
IL1R2 intro GILZ GBSTACTCAGACCCAGCAGAACATTGGGTTCCTGCTCCCCGTGAG
CTCACGGGGAGCAGGAACCCAATGTTCTGCTGGGTCTGAGTA
GYPC intro CGT GBSAATTCTCAACCAGAACATTTTGTACGGGTAG
CTACCCGTACAAAATGTTCTGGTTGAGAATT
IL1B intro CGT GBSGGTTTGGTATCAGAACATTTTGTACGCGCTG
CAGCGCGTACAAAATGTTCTGATACCAAACC
VSIG1 intro CGT GBSTTATTAACACAGTAAGAACATTTTGTACGAAACACGCC
GGCGTGTTTCGTACAAAATGTTCTTACTGTGTTAATAA