Table 6.

gRNA sequences for gene editing and activation by dCas9-SAM.

NameSequence 5′ to 3′PAM
GILZCAGGACCAAAGGAGAACATTGGG
IL1R2GACCCAGCACTGCAGCCTGGGGG
GYPCTCAACCACAACCTCTGTATCCGG
IL1BGAAAGCCATAAAAACAGCGAGGG
VSIG1ACACAGTAGCAAATATATCAAGG