Table 7.

Primer sequences for the quantification of gene expression.

NameSequence 5′ to 3′
DUSP1CTGCCTTGATCAACGTCTCA
GTCTGCCTTGTGGTTGTCCT
FKBP5TGAAGGGTTAGCGGAGCAC
CTTGGCACCTTCATCAGTAGTC
GILZCCATGGACATCTTCAACAGC
TTGGCTCAATCTCTCCCATC
IL1R2 exon 1–2CAGGTGAGCAGCAACAAGG
TGCTCCTGACAACTTCCAGA
IL1R2 exon 8–9TTTTCAGACACTACGCACCA
GATGAGGCCATAGCACAGT
GYPCTCCAGGGATGTCTGGATGG
CGAAGAGGAGGGAGACTAGG
IL1BCCACAGACCTTCCAGGAGAATG
GTGCAGTTCAGTGATCGTACAGG
VSIG1AGCCAATTTCTCACAGCTCG
AAGTAAATCTCAGAGGTCCAGC
RPL19ATGTATCACAGCCTGTACCTG
TTCTTGGTCTCTTCCTCCTTG