Table 3.

Primer sequences for the quantification of H3K27Ac in ChIP experiments.

NameSequence 5′ to 3′
IL1R2 promoterAAAAATAGGGAAACTTATGCGGC
ACCTTTTCCTCCTCACGGG
IL1R2 wt GR-peakTGCAATAAACATCCTGGGTGA
GTGTCCACCACCAATAGCAC
Positive control (SYN2)AGGAATATTTGCTGACACTTCCA
ACAGCACCTACCATATAGGCTT
Negative control (TAT)AATGGCAGCCCCTAGTCATTC
AACTGGGAGTGATACTGGTTCC