Table 3.

Primers for qPCR.

GeneGene IDForward primerReverse primer
Y45F10D.4178344GTCGCTTCAAATCAGTTCAGCGTTCTTGTCAAGTGATCCGACA
tba-1172831AGACCAACAAGCCGATGGAGTCCAGTGCGGATCTCATCAAC
csq-1181563GTGACATCTAAATGGGCACGCCTCACGGGTTTCCTCGTCAA
eif-1266853TCAGCGTGACAAGGTCAAGGGTGCACTCTGCAGTTGGACT
eif-3.C172858GGAGGACAAGGACAAGACGGAGAAGGCTCGTGGCTTTTGA
inf-1175966GGAAGGTCGACACACTCACCATGTCTCCGTGGAGGCAAGA
rpl-11.1178778GGTTTCGGAGTTCAGGAGCATTGCGGTTCAGAACGACGTA
rpl-14172818CAAGCTCACCGACTTCGAGAGAGCTCCACTCGGACGATTC