Primers for PCR amplification of the retained intragenic regions.

Gene nameForward primerReverse primer
Men1ATTTCCCAGCAGGCTTCAGGGGGATGACACGGTTGACAGC
Dvl1CCTGGGACTACCTCCAGACACCTTCATGATGGATCCAATGTA
Map4k2GCTGCAGTCAGTCCAGGAGGTCCTGTTGCTTCAGAGTAGCC
CtsaGCAATACTCCGGCTACCTCATGGGGACTCGATATACAGCA
Pol2riCGAAATCGGGAGTGAGTAGCGGTGGAAGAAGGAACGATCA
Wipf2TAGAGATGAGCAGCGGAATCTCGAGAGCTGGGGACTTGCA
FuzGACCCAGTGTGTGGACTGTGGACAAAGGCTGTGCCAGTGG
Rfx5CACCAGTTGCCCTCTCTGAACAATTCTCTTCCTCCCATGC
Fhod1CACCAGGGAGCAGAGATGATCCATCAACATTGGCCTAACC
Tcirg1AGCGACAGCACTCACTCCTTCAACACCCCTGCTTCCAGGC