Condensate-forming eIF4ET ensures adequate levels of meiotic proteins to support oocyte storage

Worm strains and maintenance

All worms were maintained at 16°C on NGM with OP50 until reaching the adult gravid stage and passaged regularly to maintain a steady population of worms. GFP and mMaple knock-ins were generated using CRISPR (44). Worm strains are listed in Table S1.

Worm synchronization and feminization

All worms with a fem-1 temperature-sensitive genotype had to be maintained at 16°C to maintain hermaphrodites. When arrested oocytes were needed for an experiment, worms were grown at 16°C until the plate was full of mostly adults and eggs. Plates were washed with 3.5 ml of dH₂O and transferred to a Falcon tube. To this, 1 ml of 5% bleach and 0.5 ml of 5M NaOH were added and the Falcon tubes spun for 1–2 min or until all adult worms were dissolved. This embryo-enriched solution was spun on a centrifuge at 1,300 RCF for 1 min, then washed in DI water twice at the same spin settings. The pellet of embryos was resuspended in 1 ml of M9 media and left to rotate at room temperature overnight. The next day, the tubes were collected and contained synchronized L1 hatchlings. These were transferred to NGM plates with OP50 and grown at 25°C for 72 h to fully feminize and mature to adults with oocytes in day 1 arrest. It is at this stage that worms were collected for all subsequent experiments.

RNAi knockdowns

RNAi was done via feeding. The target sequence for ifet-1 is AACGTGGCTAATCCAATGCTTGCAAGACTTTTCGGTCATAGTGGTGGTGATAACAACGCTTCATCTTCTGGAGCTGGTGATATAAAAGGAGGAATGCGGTTGGAAGATTTGGAGAAAGGCATGGAGTCAAAGGAACCTTCAAAAGTCAGTCCATTGCAAGATCCATCACAACAAGCACAACTTCTGCAACATCTGCAAAAATTCGCCAAACAGCAAGCAGAGTCTGGTCAGCACATACATCATCATAGACAACCAACACCACCAAATGGAGGTCCACAGCATCAACAACATTTGCATCACCCTATGGTTCATCCTGGAATGCAAATTATCGCAGATCCAAGCCTTCTTGCAAGCTTCGCACAGAATCCAGTGATTTTGAATGCCTATGTCGAGAATCAACTTCAAGAAGCAGTCAATGCTGCAATTCGTGCAAACAATGGGCAGCAGCTTCCACCACAGCTTCGTATGTTAAGCATTTTTGAATACATTTCATGATTGAATTATTTTTCAGATGAGCAACTTCGTATGGCATCCATGCGTAACAAGGCTTTCCTACAGTCTCAGACTCTCACTTTCGTTAGTCTTCAACAACAGCATCAGAACATCCAGCAGCATCAGCAACAACAACAGCATCATCAACACAAAGGTCGCACTCCTGCTATGATACCTGCGTCTGTGCAGCGGCAATTGCAGAAGAGCTCCTCAAATGCTGATCAGAAGAAAGAAAAGACGAGTCAGAGCCCGCCAGAGAGCAACCAAGAGACTTCCGACGCTCATAATCAATCTGATGCCATGAACCAACTGAAGAAATTGCACATGCAGCAGAACTATGCCAATATGGTGCAGGCAATGAATTCTGGAGTCGGATGGGCACGCGGAAACGGCGTTGTTAACGGACAACAGCAACATCCACAGCAGCAACTTCCACCAAATGTTCAAATGCTGATGGCTCAACACCAGCAAGCTCAAATGCAGCACCTCAAG.

Bacteria containing the target sequence plasmids were seeded onto NGM plates containing 1 mM IPTG and 100 μg/ml ampicillin. Worms were bleached and synchronized as described above. After rotating overnight in M9, the L1 larvae were transferred onto prepared RNAi plates and grown at 25°C for 46–72 h (depending on the experiment). Worms were then transferred off the RNAi plate once they reached day 1 of adulthood and allowed to grow on OP50 at 20°C.

Auxin treatment

Worm synchronization and feminization were conducted as described above. When worms reached day 1 of adulthood, they were transferred to 20°C. Half the adult worms were transferred to NGM plates with OP50 containing 4 mM auxin for 24 h; half were maintained on a normal OP50 plate. After auxin treatment, the worms were transferred back to a regular NGM plate with OP50 for 8 h. Both control and auxin-treated worms were then singled out to mate with three males for ∼12–16 h at 16°C. The males used were also synchronized using the above method and grown to adulthood. At the end of the mating period, adult worms were removed from the mating plates and the total amount of embryos on each plate was counted. 2 d later, the number of hatchlings on each plate was counted and % embryonic viability was calculated. Data included were only from worms that laid 34 or less embryos.

For IFET-1 depletion in embryos, embryos were extracted from IFET-1::mScarlet::AID* hermaphrodite worms using two dissection needles in a solution of M9 containing 1 mM auxin. These embryos were then imaged overnight on a Nikon widefield microscope to visualize hatching and IFET-1::mScarlet signal.

Bortezomib feeding

Agar plates were prepared by diluting bortezomib (#5.04314; MilliporeSigma) to 20 μM in OP-50 and seeding plates as above. Worms were then fed on these plates for 16–24 h to test recovery after RNAi feeding.

Viability assay

Worms were bleached and synchronized as described above. L1 larvae were grown at 25°C for 72 h to feminize. After 72 h, all adult worms on day 1 of oocyte arrest were transferred to 20°C to reduce heat stress and experiments were conducted on this population. 12–15 d 2 adults were picked and transferred to individual mating plates. fog-2 worms were also synchronized and grown at the same rates and temperatures as the feminized line. Three males per adult female were transferred to each mating plate. Worms were allowed to mate and lay eggs for 10–16 h at 16°C. All adults were then removed, and laid eggs were counted and recorded. 48 h later, all hatchling larvae were counted. Oocyte viability is calculated as the number of hatchlings divided by the number of eggs laid per mother. The average viability per strain is reported for worms that laid ≤34 eggs to maintain a brood size that matches average oocyte storage numbers.

Western blot

Worms were grown on agar plates until day 2 of adulthood. They were washed off the plate with M9 and allowed to settle at the bottom of the tube. Worms were transferred onto a fresh agar plate with no bacteria. 40 worms of each condition were picked and transferred to 25 μl DI water. 25 μl SDS was added to the samples, and all were boiled at 95° for 5–10 min (or until worms dissolve). Samples were run on SDS–PAGE gel for 30 min. Proteins were transferred onto a nitrocellulose membrane using Trans-Blot Turbo Transfer System (Bio-Rad). Nitrocellulose was blocked in 3% blocking buffer for an hour, and then, primary antibody (1:1,000) was added for overnight incubation at 4°C. Membranes were washed the next morning in TBS-T three times, then incubated with secondary antibody (1:10,000) for an hour. Membranes were washed again with TBS-T three times, and chemiluminescence was expressed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). Membranes were imaged on ChemiDoc Touch Imaging System (Bio-Rad). Western blots were quantified using FIJI. The mean gray value of any protein bands of interest was measured, and the background mean value of the blot was subtracted. The mean gray value of the control was also measured in the same way (whole lane was measured if it was a Ponceau S stain), and the values of the protein of interest were normalized to the amounts of control or total protein stained.

Collection, preparation, and staining of human ovarian tissue

Tissue was collected as described previously (45). Briefly, a 20-yr-old female patient with no known pathology or history of infertility was elected for total hysterectomy and bilateral salpingo-oophorectomy for purposes of transgender care. Informed consent was received before the procedure. The use of human ovarian tissue was approved by the Institute Review Board of the University of Texas Southwestern Medical Center (IRB#0801-404/012012-185). The ovarian tissue was placed in 4% formaldehyde directly from the operating room and incubated for 24 h for fixation. The tissue was embedded in paraffin and cut into 5-mm sections using Leica Rotary Microtome. For immunohistochemistry, the mounted paraffin sections were dewaxed and rehydrated in xylene and serial dilutions of ethanol, respectively. After a wash step with PBS, an antigen retrieval step was performed using a basic retrieval reagent (CTS013; R&D) at 90–95°C for 5 min. The slides were cooled completely in PBS before processing.

For immunohistochemistry, the tissue was inserted into a solution containing 10% goat serum, 3% BSA, and 0.03% Triton X-100 (blocking solution) for 1 h. The tissue was then incubated overnight with primary antibody at 4°C. The following primary antibodies were used: directly labeled mouse monoclonal anti-HSP60 (1:500 dilution; 66041-1-Ig; Proteintech) and rabbit polyclonal anti-EIF4ENIF1 (1:500 dilution; ab277638; Abcam). After primary antibody incubation, a series of washes were performed with PBS. The tissue was then incubated with a goat anti-rabbit secondary antibody (1:1,000 dilution, A-11008; Invitrogen) for 1 h before staining for DNA with Vectashield (DAPI) (H-1000-10; VectorLabs). Negative controls were included by incubating with no primary antibody. The directly labeled anti-HSP60 was created using an Alexa Fluor 647 Lightning-Link kit (Abcam) following their instructions.

Confocal microscopy

Worms were imaged using a Nikon Eclipse Ti2-E microscope with a Yokogawa confocal scanner unit (CSU-W1), piezo Z stage, and an iXon Ultra 888 EMCCD camera (Andor), controlled by Nikon Elements software. Images were collected using a 60X water (NA 1.2) or 100X silicon (NA 1.35) immersion objective, 0.3 μm Z-stacks, 2 × 2 binning, 15% laser power, and 100-ms exposures. Human tissue and worm oocytes were also imaged using a Nikon AX-R confocal microscope with a 40X silicone (NA 1.25) objective.

Proteomics

Worms were feminized and synchronized as described above and plated on three separate plates at 25°C. When the worms reached day 2 of adulthood, they were washed in M9 media for 15 min to wash off bacteria. For each experimental group, three groups of 30 worms each were collected and transferred to 20 μl of dH₂O in three separate Eppendorf tubes. 20 μl SDS was added to the tubes, and samples were boiled for 5–10 min (or until all worms were dissolved into SDS solution). These samples were run on an SDS–PAGE gel for 3 min to allow all the sample to enter the gel, and then, the gel was stained with a Coomassie dye. The protein band was cut out of the gel.

Gel samples were digested overnight with trypsin (Pierce) after reduction and alkylation with DTT and iodoacetamide (Sigma-Aldrich). After solid-phase extraction cleanup with an Oasis HLB μElution plate (Waters), the resulting peptides were reconstituted in 2% (vol/vol) acetonitrile (ACN) and 0.1% trifluoroacetic acid in water. 1 μg of each sample was injected onto an Orbitrap Fusion Lumos mass spectrometer coupled to an UltiMate 3000 RSLCnano liquid chromatography system (Thermo Fisher Scientific). Samples were injected onto a 75 μm i.d., 75-cm-long EasySpray column (Thermo Fisher Scientific), and eluted with a gradient from 0 to 28% buffer B over 90 min. Buffer A contained 2% (vol/vol) ACN and 0.1% formic acid in water, and buffer B contained 80% (vol/vol) ACN, 10% (vol/vol) trifluoroethanol, and 0.1% formic acid in water. The mass spectrometer operated in positive ion mode with a source voltage of 2.5 kV and an ion transfer tube temperature of 300°C. MS scans were acquired at 120,000 resolution in the Orbitrap, and up to 10 MS/MS spectra were obtained in the Orbitrap for each full spectrum acquired using higher energy collisional dissociation (HCD) for ions with charges 2–7. Dynamic exclusion was set for 25 s after an ion was selected for fragmentation.

Raw MS data files were analyzed using Proteome Discoverer v3.0 (Thermo Fisher Scientific), with peptide identification performed using Sequest HT searching against the C. elegans reviewed protein database from UniProt along with the sequence of fluorescent mMaple protein. Fragment and precursor tolerances of 10 ppm and 0.6 D were specified, and three missed cleavages were allowed. Carbamidomethylation of Cys was set as a fixed modification, and oxidation of Met was set as a variable modification. The false discovery rate cutoff was 1% for all peptides.

Data were analyzed in XML format. All protein abundance was normalized by averaging the sum of total proteins in each sample sent and getting a ratio to the average of the control samples sent. The ratios derived were used to adjust the protein abundance values up or down accordingly. From these normalized values, the fold change and P-value (two-tailed, unequal variance) were calculated. Anything with a P-value below 0.05 was deemed significant. Data were plotted using GraphPad Prism. Identified proteins are listed in Supplemental Data 1. GO-term analysis was conducted using PANGEA (https://www.flyrnai.org/tools/pangea/web/home/6239).

Transcriptomics

Worms were synchronized, feminized, and grown on two 100-mm plates. When worms reached day 2 of adulthood, they were washed off the plates with M9 and rotated for 20 min to remove all the bacteria. Worms were rinsed twice with M9. Total RNA was extracted from worms with Arcturus PicoPure RNA Isolation Kit (Applied Biosystems). Total RNA was shipped to Novogene. RNA degradation and contamination were monitored on 1% agarose gels. RNA purity was checked using the NanoPhotometer spectrophotometer (IMPLEN). RNA integrity and quantitation were assessed using RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies).

A total amount of 1 μg RNA per sample was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB) following the manufacturer’s recommendations, and index codes were added to attribute sequences to each sample. Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in NEBNext First Strand Synthesis Reaction Buffer (5X). First strand cDNA was synthesized using random hexamer primer and M-MuLV Reverse Transcriptase (RNase H-). Second strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities. After adenylation of 3′ ends of DNA fragments, NEBNext Adaptor with a hairpin loop structure was ligated to prepare for hybridization. To select cDNA fragments of preferentially 150∼200 bp in length, the library fragments were purified with the AMPure XP system (Beckman Coulter). Then, 3 μl USER Enzyme (NEB) was used with size-selected, adaptor-ligated cDNA at 37°C for 15 min followed by 5 min at 95°C before PCR. Then, PCR was performed with Phusion High-Fidelity DNA polymerase, universal PCR primers, and index (X) primer. PCR products were purified (AMPure XP system), and library quality was assessed on the Agilent Bioanalyzer 2100 system.

The clustering of the index-coded samples was performed on cBot Cluster Generation System using PE Cluster Kit cBot-HS (Illumina) according to the manufacturer’s instructions. After cluster generation, the library preparations were sequenced on an Illumina platform and paired-end reads were generated. Raw data (raw reads) of FASTQ format were firstly processed through fastp. In this step, clean data (clean reads) were obtained by removing reads containing adapter and poly-N sequences and reads with low quality from raw data. At the same time, Q20, Q30, and GC contents of the clean data were calculated. All the downstream analyses were based on the clean data with high quality.

Reference genome and gene model annotation files were downloaded from the genome website browser (NCBI/UCSC/Ensembl) directly. Paired-end clean reads were aligned to the reference genome using Spliced Transcripts Alignment to a Reference (STAR) software, which is based on a previously undescribed RNA-seq alignment algorithm that uses sequential maximum mappable seed search in uncompressed suffix arrays followed by seed clustering and stitching procedure. STAR exhibits better alignment precision and sensitivity than other RNA-seq aligners for both experimental and simulated data. Differential expression analysis between two conditions/groups (three biological replicates per condition) was performed using the DESeq2 R package. DESeq2 provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting P-values were adjusted using the Benjamini and Hochberg approach for controlling the false discovery rate. Genes with an adjusted P-value < 0.05 found by DESeq2 were assigned as differentially expressed.

Before differential gene expression analysis, for each sequenced library, the read counts were adjusted by trimmed mean of M-values (TMM) through one scaling normalized factor. Differential expression analysis of two conditions was performed using the edgeR R package. The P-values were adjusted using the Benjamini and Hochberg methods. Corrected P-value of 0.005 and |log2(Fold Change)| of 1 were set as the threshold for significantly differential expression. Identified transcripts are listed in Supplemental Data 2.

Puromycin assay

Worms were synchronized and grown at 25°C on 100-mm NGM plates until they reached day 2 of adulthood. They were washed off the plates with M9 buffer and rinsed in an Eppendorf tube with S-Basal Medium (100 mM NaCl, 5 mM K₂HPO₄, 50 mM KH₂PO₄, 5 μg/ml cholesterol, 10 mM potassium citrate, 3 mM MgSO₄, 1% trace metal solution) twice. 250 μl of S-Basal Medium was added to the live worm pellet along with 50 μl of 10 mg/ml puromycin and 200 μl of concentrated OP50 and topped off to 1 ml with S-Basal Medium. The tubes were shaken at 200 RPM for 4 h at room temperature in a Thermomixer (Eppendorf). After 4 h, tubes were collected, and the worms were washed with S-Basal three times. Worms were resuspended in 300 μl lysis buffer with protease inhibitors (150 mM NaCl, 50 mM Hepes, 1 mM EDTA, 1% Triton X-100, 0.5% SDS) and flash-frozen in liquid nitrogen. The tubes were placed on ice and sonicated five to eight times at 20–30% amplitude for 2 s at a time (until most carcasses were dissolved). They were then spun at 13,000 RPM for 30 min, and 300 μl of the supernatant was collected. 20% vol/vol of TCA was added to solution, and the protein was allowed to precipitate for 30 min on ice. Tubes were spun at 14,000 RPM for 5 min, and the supernatant was pipetted off. The pellet was washed twice in 90% acetone and then resuspended and boiled in 40 μl 2X SDS loading buffer. Samples were run on an SDS–PAGE gel, transferred to nitrocellulose, and first stained with Ponceau S stain and imaged. Membranes were then stained with anti-puromycin antibody (MABE343; MilliporeSigma) and imaged using a ChemiDoc imager (Bio-Rad).

Immunostaining of C. elegans

The tube fixation and collagenase protocol was adapted from protocols in www.wormbook.org. Briefly, worms were fixed in 4% formaldehyde in PBS in an Eppendorf tube. Tubes were flash-frozen in liquid nitrogen and subsequently thawed two to three times. They were shaken at 37°C for 3 h. Fixative was then removed and washed off with PBST. Worms were shaken at 100 rpm in B-mercaptoethanol solution (5% BME, 1% Triton X-100, 120 mM Tris) for 2 h at 37°C. Tubes were spun at 1,000 RCF and washed with PBST up to 10 times if needed, or until fixative is no longer detectable. Samples were transferred to a fresh tube after half the washes. 200 μl of collagenase solution (100 mM Tris, 1 mM CaCl₂, 0.1% Triton X-100, pH 7.4, 2,000 U collagenase) was added, and worms were shaken at 37°C at 250 rpm for 38–48 h (depending on the stock of collagenase). Incubation was stopped when a majority of worms were broken in half. Collagenase was washed off, and worms were blocked in 1 ml blocking buffer (PBS, 0.5% Triton X-100, 1 mM EDTA, 5% BSA, 0.05% sodium azide) at room temperature for 1 h. The blocking buffer was removed, and worms were incubated with primary antibody in blocking buffer (1:1,000) overnight at 4°C. Worms were washed three times for 15-min washes with antibody buffer (blocking buffer but with only 0.1% BSA) and then incubated with secondary antibody in blocking buffer (1:10,000) for 3 h at room temperature. Three more 15-min washes were done and worms transferred onto a slide with an agar pad or wire spacing. Mounting medium was added, and slides were imaged on a spinning disk confocal microscopy. Rabbit polyclonal anti-IFET-1 and anti-CAR-1 antibodies were made by GenScript.

Statistical analyses

Statistical analyses were performed using GraphPad Prism. The indicated tests, the n values, and significant values are displayed in the figure legends or on the figures themselves. Significance was reported as follows: *P < 0.05, **P < 0.005, ***P < 0.0005, ****P < 0.00005.