POLRMT overexpression increases mtDNA transcription without affecting steady-state mRNA levels

Generation and genotyping of transgenic Polrmt-overexpressing mice

BAC clones containing a fragment of chromosome 10, including the entire Polrmt gene, were purchased from the C57Bl/6N BAC library of DNA Bank, RIKEN BioResource Center. The BAC clone BgN01-092D16 was modified by Red/ET recombination using the counter-selection BAC modification kit (Genebridges). A silent point mutation 420G>T was introduced into exon 3 leading to a unique HindIII restriction site. Positive clones were verified by PCR followed by HindIII restriction digest, Sanger sequencing, and Southern blotting. The modified BAC was purified via a cesium chloride gradient and injected into the pronucleus of fertilized oocytes as described in Milenkovic et al (2013). Founders (+/BAC-Polrmt) were identified by PCR and restriction enzyme analysis of genomic DNA to detect gain of the HindlII site in the Polrmt gene. Tail DNA from offspring was genotyped for the presence of the BAC transgene by analyzing 100 ng of tail DNA with the GoTaq PCR reaction kit (Promega) according to the manufacturer’s instruction by adding forward primer 5′-GAG​GCT​CGG​GTG​CGG​CAG​CTC -3′ and reverse primer 5′-GTG​CAG​TGT​GAG​CAC​CTG​CTG​TC-3′ for PCR with an initial denaturation for 3 min at 95°C, followed by 40 cycles for 30 s at 95°C, 30 s at 60°C, and 45 s at 72°C. The reaction was ended with extension for 10 min at 72°C. Mice were maintained heterozygous on an inbred C57BL/6N background.

Ethical statement

Animals were housed in individually ventilated cages under specific pathogen–free conditions with constant temperature (21°C) and humidity (50–60%) and a 12-h light/dark cycle. All mice were fed commercial rodent chow and provided with acidified water ad libitum. Mice were euthanized by cervical dislocation. The health status of the animals is specific pathogen free according to the Federation of the European Laboratory Animal Science Association (FELASA) recommendations. All animal procedures were conducted in accordance with European, national and institutional guidelines and protocols (no.: AZ.: 84-02.05.50.15.004, AZ.: 84-02.04.2015.A103 and 84-02.04.2016.A420) were approved by the Landesamt für Natur, Umwelt und Verbraucherschutz, Nordrhein-Westfalen, Germany.

Exercise challenges and phenotyping protocol

DNA isolation, Southern blot analysis, and mtDNA quantification

For genotyping and pyrosequencing, DNA from tail or ear-clip biopsies DNA was extracted using chloroform and ethanol precipitation. For Southern blotting or qPCR, total DNA was isolated from mouse tissues using the DNeasy Blood & Tissue Kit (QIAGEN) as previously described (Kühl et al, 2016). Briefly, snap frozen tissues were ground in a cold mortar. About 20 mg of ground tissue was used to extract DNA using the blood and tissue kit or the Gentra Puregene tissue kit (QIAGEN) following the manufacturer’s instructions. All samples used for Southern blotting and qPCR were treated with RNase (QIAGEN). For Southern blot analysis, total DNA (3–10 μg) was digested with SacI endonuclease, fragments were separated by agarose gel electrophoresis, transferred to nitrocellulose membranes (Hybond-N⁺ membranes, GE Healthcare), and hybridized with alpha-³²P-dCTP–labeled probes to detect total mtDNA (pAM1) using nuclear DNA (18S rDNA) as loading control. mtDNA was also measured by semiquantitative PCR carried out on 4 ng of total DNA in a 7900HT Real-Time PCR System (Applied Biosystems) using TaqMan probes specific for the mt-Co1, mt-Co2, mt-Cytb, mt-Nd5, mt-Nd6, and 18S genes (Applied Biosystems).

Pyrosequencing

Quantification of Polrmt gene dosage was performed on tail DNA using a PyroMark-Q24 pyrosequencer (QIAGEN). Allele quantification assay was developed using PyroMark assay design software v. 2.0 (QIAGEN). A single PCR reaction was used to amplify a 192-bp fragment spanning the c.420G>T mutation site, using a biotinylated primer ([Btn]TCTTGCTTGGCTGCAGGTAG) and a non-biotinylated primer (AGA​GGC​GCC​AAA​AGG​AAG​TT). PCR products were combined with distilled water, PyroMark binding buffer (QIAGEN), and 1 μl Streptavidin Sepharose high performance beads (GE Healthcare). Next, the PCR products were purified and denatured using a PyroMark Q24 vacuum workstation (QIAGEN). Sequencing was performed with PyroMark Gold Q24 reagents according the manufacturer’s instructions using the sequencing primer (CAA​GAT​CTG​GAA​CAA​GAA). Relative allele frequencies were calculated using the PyroMark-Q24 Advance v.3.0.0 software (QIAGEN).

RT–PCR, qRT-PCR, and Northern blot analysis

RNA was isolated by using the miRNeasy Mini Kit (QIAGEN). Reverse transcription PCR (RT–PCR) was carried out after cDNA synthesis using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time quantitative reverse transcription PCR (qRT-PCR) was performed using the Taqman 2x Universal PCR master mix, No Amperase UNG (Applied Biosystems). The quantity of transcripts was normalized to the TATA-binding protein (Tbp) RNA as a reference gene transcript. For Northern blotting, 1–2 μg of total RNA was denatured in RNA sample loading buffer (Sigma-Aldrich), separated on 1.2 or 1.8% formaldehyde-MOPS agarose gels before transferring onto Hybond-N⁺ membranes (GE Healthcare) overnight. After UV crosslinking, the blots were hybridized with various probes at 42°C or 65°C in RapidHyb buffer (Amersham) and thereafter washed in 2x and 0.2x SSC/0.1% SDS before exposure to film. Mitochondrial probes used for visualization of mt-mRNA and mt-rRNA levels were restriction fragments labeled with α-³²P-dCTP and a random priming kit (Agilent). Different mitochondrial tRNAs and 7S RNA were detected using specific oligonucleotides labeled with γ-³²P-ATP. Radioactive signals were detected by autoradiography.

De novo transcription and replication assays

In organello transcription and replication assays were performed on mitochondria isolated from mouse hearts by differential centrifugation as described before (Agaronyan et al, 2015; Kühl et al, 2016; Jiang et al, 2021; Misic et al, 2022). In organello transcription assays were carried out as previously reported (Lagouge et al, 2015). For each in organello replication assay, 1 mg of purified mitochondria were washed in 1 ml of incubation buffer (10 mM Tris, pH 7.4, 25 mM sucrose, 75 mM sorbitol, 100 mM KCl, 10 mM K₂HPO₄, 50 μM EDTA, 5 mM MgCl₂, 10 mM glutamate, 2.5 mM malate, 1 mg/ml BSA, and 1 mM ADP) and resuspended in 500 μl incubation buffer supplemented with 50 μM of dCTP, dTTP, dGTP, and 20 μCi of α-³²P-dATP (PerkinElmer) and incubated for 2 h at 37°C as reported (Matic et al, 2018). For chase experiments, radiolabeled mitochondria were washed and incubated for 2 h in incubation buffer without radioactivity. After incubation, mitochondria were washed three times in 10 mM Tris, pH 6.8, 0.15 mM MgCl₂, and 10% glycerol. An aliquot of radiolabelled mitochondria was collected for immunoblotting with the VDAC (Millipore) or SDHA (Invitrogen) as a loading control. MtDNA was isolated by phenol/chloroform extractions or by Puregene Core Kit A (QIAGEN) and radiolabeled replicated DNA was analyzed by Southern blotting and visualized by autoradiography. Quantifications of transcript levels were performed using the program Multi Gauge with images generated from a PhospoImager instrument.

RNA sequencing

RNA was isolated from crude heart mitochondria using the miRNeasy Mini Kit (QIAGEN), and the concentration, purity, and integrity were confirmed using a BioAnalyser. RNA sequencing libraries were constructed using the Illumina TruSeq Sample Prep Kit. Paired end deep sequencing of the mitochondrial RNAs was performed on an Illumina MiSeq according to the manufacturer’s instructions. RNA-Seq was performed on mitochondrial RNA from three biological replicates of each genotype: wild-type, Polrmt-overexpressing, Lrpprc-overexpressing, and Polrmt and Lrpprc double overexpressing mice aged 14 wk. The alignment to the Mus musculus reference genome (GRCm38) was performed using HISAT2 version 2.0.5 (--dta) (Kim et al, 2019). Alignment files were sorted and indexed with SAMtools version 1.3.1 (Li et al, 2009). Transcript abundances were estimated with StringTie version 1.2.4 (−e-B) (Pertea et al, 2016) and raw reads count matrices at gene level were extracted with the included prepDE.py script on Python version 2.7.6. Differential gene expression was performed with DESeq version 1.14.1 (Love et al, 2014) after filtering of low abundance genes. Genes with an adjusted P-value < 0.05 were considered statistically significant.

Western blots and antisera

For crude mitochondria isolation, mouse tissues were homogenized using a Potter S homogenizer (Sartorius) in mitochondrial isolation buffer (320 mM sucrose, 1 mM EDTA, and 10 mM Tris–HCl, pH 7.4) containing complete protease inhibitor cocktail (Roche) followed by two rounds of differential centrifugation. Isolation of crude mitochondria from skeletal muscle was performed as previously described (Frezza et al, 2007). The protein concentration of protein samples was determined using Bradford reagent (Bio-Rad) and BSA as a standard. Proteins were separated by SDS–PAGE (using 4–12% Tris-glycine gels, Invitrogen) and then transferred onto polyvinylidene difluoride membranes (GE Healthcare) using wet tank blotting (25 mM Tris, 192 mM glycine, and 20% ethanol) at 4°C at 400 mA for 2 h or at 80 mA overnight. Immunoblotting was performed according to standard techniques using enhanced chemiluminescence (Immun-Star HRP Luminol/Enhancer from Bio-Rad). The following antibodies were used: Total OXPHOS Rodent WB Antibody Cocktail containing NDUFB8 (Complex I), SDHB (Complex II), mt-COI (CIV), UQRC2 (CIII), and ATP5A1 (CV) (ab110413; Abcam), SDHA (Invitrogen), TFAM (Abcam), VDAC (porin) from Mitoscience, and GRSF1, SSBP1, MRPL12, MRPS35, and MRPL37 from Sigma-Aldrich. Further, polyclonal antisera were used to detect TFB2M, SLIRP, LRPPRC, TWINKLE, TEFM, and POLRMT proteins (Ruzzenente et al, 2012; Milenkovic et al, 2013; Kühl et al, 2014; Lagouge et al, 2015; Jiang et al, 2019). Western blots were quantified with Fiji Image J, and each blot was normalized to the average or WT run on the same blot.

Ultrapure mitochondria isolation, peptide digestion, and cleanup for label-free mass spectrometry

Mitochondria were isolated from mouse hearts using differential centrifugation as previously reported (Kühl et al, 2016). For proteomic analysis, crude mitochondrial pellets were washed in 1xM buffer (220 mM mannitol, 70 mM sucrose, 5 mM Hepes, pH 7.4, 1 mM EGTA, pH 7.4; pH was adjusted with potassium hydroxide; supplemented with EDTA-free complete protease inhibitor cocktail and PhosSTOP Tablets [Roche]) and purified on a Percol density gradient (12%:19%:40% prepared with buffer 2xM) via centrifugation in a SW41 Ti Swinging-Bucket rotor (Beckman) at 15,500 rpm at 4°C for 1 h in a Beckman Coulter Optima L-100 XP ultracentrifuge using 14 × 89 mm Ultra-Clear centrifuge tubes (Beckman Instruments Inc.) as previously described (Kühl et al, 2017). Mitochondria were harvested at the interphase between 19% and 40%, washed three times with buffer 1xM, and the mitochondrial pellets were frozen at −80°C. Purified frozen mitochondria pellets were suspended in lysis buffer (6 M guanidinium chloride, 10 mM Tris(2-carboxyethyl)phosphine hydrochloride, 40 mM chloroacetamide, and 100 mM Tris–HCl) (Kulak et al, 2014). After complete lysis, the samples were diluted 1:10 in 20 mM Tris–HCL, pH 8.0, and 80 μg of protein was mixed with 3 μg of trypsin gold (Promega) and incubated overnight at 37°C to achieve complete digestion. The peptides were cleaned with home-made STAGEtips (Rappsilber et al, 2003) (Empore Octadecyl C18; 3 M) and eluted in 60% acetonitrile/0.1% formic acid buffer. The samples were dried in a SpeedVac apparatus (Eppendorf concentrator plus 5305) at 45°C, and the peptides were suspended with 0.1% formic acid. Approximately 1.5 μg of peptides was analyzed by LC–MS/MS.

LC–MS/MS analysis

For mass spectrometric analysis, the peptides were separated on a 25-cm, 75-μm internal diameter PicoFrit analytical column (New Objective, Part No. PF7508250) packed with 1.9 μm ReproSil-Pur 120 C18-AQ medium (Mat. No. r119.aq; Dr. Maisch) using an EASY-nLC 1000 or EASY-nLC 1200 (Thermo Fisher Scientific). The column was maintained at 50°C. Buffer A and B were 0.1% formic acid in water and 0.1% formic acid in acetonitrile, respectively. For the analysis using the EASY-nLC 1,200 system, buffer B was 80% acetonitrile, 0.1% formic acid. Peptides were separated on a segmented gradient from 2% to 5% buffer B for 10 min, from 5% to 20% buffer B for 100 min, from 20% to 25% buffer B for 10 min, and from 25% to 45% buffer B for 10 min at 200 nl/min (EASY-nLC 1,000). Using the EASY-nLC 1200 system, peptides were separated on a segmented gradient from 3% to 6% buffer B for 10 min, from 6% to 25% buffer B for 100 min, from 25% to 31% buffer B for 10 min, and from 31% to 60% buffer B for 10 min, at 200 nl/min. Eluting peptides were analyzed on a QExactive HF mass spectrometer (Thermo Fisher Scientific). Peptide precursor mass to charge ratio (m/z) measurements (MS1) were carried out at 60,000 resolution in the 300–1,800 m/z range. The top 10 most intense precursors with charge state from two to seven only were selected for HCD fragmentation using 25% collision energy. The m/z of the peptide fragments (MS2) were measured at 30,000 resolution using an AGC target of 2 × 10⁵ and 80 ms maximum injection time. Upon fragmentation, the precursors were put on an exclusion list for 45 sec. Peptides from the three different tissues were analyzed in a single run.

LC–MS/MS data analysis

The raw data were analyzed with MaxQuant version 1.4.1.2 using the integrated Andromeda search engine (Cox et al, 2011). Peptide fragmentation spectra were searched against the canonical and isoform sequences of the mouse reference proteome (proteome ID UP000000589, August 2015 from UniProt). The database was complemented with 245 sequences of contaminating proteins by MaxQuant. For the analysis methionine oxidation and protein N-terminal acetylation were set as variable modifications. The digestion parameters were set to “specific” and “Trypsin/P,” allowing for cleavage after lysine and arginine also when followed by proline. The minimum number of peptides and razor peptides for protein identification was 1; the minimum number of unique peptides was 0. Protein identification was performed at a peptide spectrum matches and protein false discovery rate (FDR) of 0.01. The “second peptide” option was on to identify co-fragmented peptides. Successful identifications were transferred between the different raw files using the “Match between runs” option, using a match time window of 0.7 min. Label-free quantification (LFQ) (Cox et al, 2014) was performed using an LFQ minimum ratio count of 2.

Protein quantification analysis

Analysis of the label-free quantification (LFQ) results was carried out using the Perseus computation platform (Tyanova et al, 2016), version 1.5.0.0 and R, version 3.3.0 (R Development Core Team, 2010). For the analysis, LFQ intensity values were loaded in Perseus and all identified proteins marked as “Reverse,” “Only identified by site,” and “Potential contaminant” were removed. The corresponding +/+ and the +/T genotypes were loaded separately in Perseus, the LFQ intensity values were log₂ transformed and all proteins that contained less than two to five missing values in one of the groups (+/+ or +/T) were removed. Missing values in the resulting subset of proteins were imputed with a width of 0.3 and down shift of 1.8. Imputed LFQ intensities were loaded into R where a two-sided moderated t test analysis was performed using limma, version 3.30.13 (Cox et al, 2011). Proteins with an adjusted P-value (“BH” correction) of less than 0.05 were designated as differentially expressed. Our list of differentially expressed proteins was combined with the pathway annotations from MitoCarta3.0 (Rath et al, 2021).

Bioenergetic determinations

Mitochondrial oxygen consumption flux was measured at 37°C using 65–125 μg of crude mitochondria diluted in 2.1 ml of mitochondrial respiration buffer (120 mM sucrose, 50 mM KCl, 20 mM Tris–HCl, 4 mM KH₂PO₄, 2 mM MgCl₂, and 1 mM EGTA, pH 7.2) in an Oxygraph-2k (Oroboros Instruments, Innsbruck, Austria). The oxygen consumption rate was measured using either 10 mM pyruvate, 10 mM glutamate, and 5 mM malate or 10 mM succinate and 10 nM rotenone. Oxygen consumption was assessed in the phosphorylating state with 1 mM ADP (state 3) or non-phosphorylating state by adding 2.5 μg/ml oligomycin (state 4). Respiration was uncoupled by successive addition of carbonyl cyanide m-chlorophenyl hydrazone (CCCP) up to 3 μM to reach maximal respiration.

To measure mitochondrial respiratory chain complex activities 15–50 μg of mitochondria were diluted in phosphate buffer (KH₂PO₄ 50 mM, pH 7.4), followed by spectrophotometric analysis of isolated respiratory chain complex activities at 37°C, using a Hitachi UV-3600 spectrophotometer. To follow citrate synthase activity, increase in absorbance at 412 nm was recorded after addition of acetyl-CoA (0.1 mM), oxaloacetate (0.5 mM) and DTNB (0.1 mM). Succinate dehydrogenase (SDH) activity was measured at 600 nm after the addition of 10 mM succinate, 35 μM dichlorphenolindophenol (DCPIP) and 1 mM KCN. NADH dehydrogenase activity was determined at 340 nm after the addition of 0.25 mM NADH, 0.25 mM decylubiquinone, and 1 mM KCN and controlling for rotenone sensitivity. Cytochrome c oxidase activity was measured by standard TMPD ascorbate/KCN sensitive assays. To assess the ATPase activity, 65 μg/ml frozen isolated mitochondria was incubated at 37°C in triethanolamine 75 mM, MgCl₂ 2 mM, pH 8.9. Mitochondria were preincubated 2 min with alamethicin 10 μg/ml before addition of 2 mM of ATP. The samples were removed every 2 min and precipitated in 7% HClO₄, 25 mM EDTA (50 μl). Phosphate was quantified by incubating an aliquot in 1 ml molybdate 5.34 mM, ferrous sulfate (28.8 mM), and H₂SO₄ 0.75 N for 2 min. The absorbance was assessed at 600 nm. In parallel, oligomycin (2.5 μg per ml protein) was added to the mitochondrial suspension to determine the oligomycin insensitive ATPase activity. Each activity was normalized to mg protein by using the Lowry-based Bio-Rad protein DC kit. All chemicals were obtained from Sigma-Aldrich.

Statistical analysis

Each mouse was considered an independent biological replicate (n), and repeated measurements from the same animal were treated as technical replicates. Unless otherwise indicated, ≥3 biological replicates from the transgenic mouse strain and their respective age-matched control mice were used for all experiments. Statistical analyses for RNA-Seq were performed as described above. Linear modeling was used to assess the effects of Genotype, Age, and their interaction (lm(output.variable ∼ Genotype * Age)) on Polrmt transcript levels, tissue respirometry, mitochondrial transcripts measured by Northern blot, and mtDNA levels measured by Southern blot. Estimated marginal means (EMMs) were computed using the emmeans package in R to evaluate group differences. Pairwise comparisons between genotypes were performed within each age-group using Tukey’s method to adjust for multiple comparisons. Statistical testing for POLRMT protein levels was performed using a two-sided t test. In organello experiments were analyzed using a one-sample, two-tailed t test with μ:100 as each experiment was normalized as percentage of the WT control that was run simultaneously. Statistical analyses were performed in Excel or R Studio version 1.1.383. Data visualization in R was performed using ggplot2 version 2.2.1. The definition of center and precision measures, and P-values are provided in the figure legends. P < 0.05 was considered significant.