Article Figures & Data
Figures
- Figure S1. CRISPR/Cas9 vectors to target the murine genomic locus of KrasG12D.
(A, B) Plasmid map of the Cas9/synthetic guide RNA (sgRNA) expression vector LentiCRISPR v2 and (B) PX458. (C, D) Sequence of sgRNA1 (C) and sgRNA2 (D) targeting the murine KrasG12D allele. (E, F) Cas9-overexpressing KPC689 cells were generated by transfection with LentiCRISPR V2 with subsequent puromycin selection and clonal expansion. (E) cas9 mRNA expression levels were tested with quantitative PCR. Data are normalized to 18s levels and are presented as presented as mean ± standard deviation. Unpaired t test performed. (F) Cas9 protein expression was validated with Western blotting. Loading control: β-actin. ***P < 0.001.
Source data are available for this figure.
Source Data for Figure S1[LSA-2020-00875_SdataFS1.1.xlsx][LSA-2020-00875_SdataFS1.2.tif]
- Figure 1. CRISPR/Cas9–mediated gene editing suppresses oncogenic KrasG12D in vitro.
KPC689 cells were transfected with 5 μg plasmid DNA (Cas9/KrasG12D gRNA1/2 with LentiCRISPR V2 or PX458 backbone, and the Cas9 vector controls) by Lipofectamine 2000 for 48 h. (A) Epifluorescence microscopy imaging was used to evaluate transfection efficiency of lipofectamine 2000 by using GFP/Cas9 vector control (PX458) plasmid. Scale bar, 100 μm. (B, C) Quantitative PCR was used to evaluate mRNA expression levels of cas9 (B) and KrasG12D (C). (C) Data in (C) are normalized to 18s and untransfected control. One-way ANOVA with Tukey’s multiple comparisons test was used to evaluate mean differences among groups based on ΔCT values. (D) T7/Surveyor assay was used to evaluate gene editing in genomic DNA of KPC689 cells following transfection with Lipofectamine after 48 h. All results are expressed as mean ± standard deviation. ***P < 0.001, ****P < 0.0001.
Source data are available for this figure.
Source Data for Figure 1[LSA-2020-00875_SdataF1.xlsx]
- Figure 2.
Exosome-mediated delivery of CRISPR/Cas9 disrupts oncogenic KrasG12D in vitro and inhibits proliferation. (A) Representative size distribution and concentration of HEK293T exosomes measured by nanoparticle tracking analysis. (B) Representative Western blot for exosome markers Alix and CD81 and exclusion markers calnexin and β-actin. Cell, HEK293T cell lysate; Exo, HEK293T exosomes. (C, D, E) Quantitative PCR was used to evaluate mRNA expression levels of cas9 (C), KrasG12D (D), and WT Kras (E) of KPC689 cells treated with HEK293T exosomes (2,500 exosomes/cell) containing plasmid DNA (10 μg DNA/109 exosomes) every day for 3 d. (C) Data in (C) are normalized to 18s. (D, E) Data in (D, E) are normalized to 18s and untransfected control. (C, D) One-way ANOVA with Tukey’s multiple comparisons test was used to evaluate mean differences among groups based on ΔCT values for (C, D). (E) Brown–Forsythe ANOVA with Dunnett’s T3 multiple comparisons test was used to evaluate mean differences among groups based on ΔCT values for (E). (F) Western blot for KrasG12D, pERK1/2, total ERK1/2, and β-actin (left panel) of KPC689 cells following treatment with exosomes containing CRISPR/Cas9 plasmid DNA. Quantification of KrasG12D (normalized to β-actin) as assessed via Western blot (right panel). Data are normalized to untreated. One sample t test performed comparing each group to untreated. Full length blots are presented in Fig S3A. (G) Quantification of phospho-ERK1/2 (normalized to total ERK1/2 and β-actin) as assessed via Western blot (right panel). Data are normalized to untreated. One sample t test performed comparing each group to untreated. Full length blots are presented in Fig S3A. (H) T7/Surveyor assay was used to evaluate editing in genomic DNA of KPC689 cells. (I) MTT assay was used to evaluate cell viability/proliferation rates in KPC689 over the course of 72 h following treatment with exosomes loaded with CRISPR/Cas9 plasmid DNA. Two-way ANOVA with Tukey’s multiple comparison test was performed. Data are expressed as mean ± standard deviation. ***P < 0.001, ****P < 0.0001, ns, not significant.
Source data are available for this figure.
Source Data for Figure 2[LSA-2020-00875_SdataF2.1.xlsx][LSA-2020-00875_SdataF2.2.tif]
- Figure S2. Uncropped Western blots of exclusion and exosomal markers and protein expression of GFP and Cas9 in cells treated with exosomes containing plasmid DNA.
(A) Uncropped full blots of CD81, alix, calnexin, and β-actin. Blots correspond to the images displayed in Fig 2B. Cell, HEK293T cell lysate; Exo, HEK293T exosomes. (B) GFP copy number analysis of exosomes loaded with PX458 plasmid DNA. −DNase, no DNase treatment; +DNase, with DNase treatment. Data are presented as presented as mean ± standard deviation. (C) Images of KPC689 cells treated with exosomes containing PX458 plasmid. Scale bar, 100 μm. (D) Western blot for Cas9 protein in HEK293T cells treated with exosomes loaded with LentiCRISPR v2 plasmid.
Source data are available for this figure.
Source Data for Figure S2[LSA-2020-00875_SdataFS2.xlsx]
- Figure S3. Uncropped Western blots of KPC689 cells treated with exosomes containing plasmid DNA.
(A) Uncropped full blots of KrasG12D, pERK1/2, total ERK, and β-actin. Blots correspond to the images in Fig 2F and quantification in Fig 2F and G.
- Figure S4. Exosome-mediated delivery of in vitro transcribed (IVT) synthetic guide RNA (sgRNA) induces gene editing in Cas9 overexpressing cells to disrupt oncogenic KrasG12D.
(A) Generation of IVT sgRNA. Starting from a plasmid sgRNA vector with T7 promoter, KrasG12D sgRNA1/2 was first PCR-amplified, run on agarose gel to confirm amplicon size, and DNA concentration was quantified with NanoDrop. The PCR products were purified and used as templates for the vitro synthesis of sgRNA. (B) HEK293T exosomes were loaded with IVT-KrasG12D sgRNA1 using Exo-Fect and used to treat Cas9-overexpressing KPC689 cells. Gene editing was tested with T7/Surveyor assay. (C) mRNA expression level of KrasG12D in Cas9-overexpressing cells was assessed by Quantitative PCR. Data are normalized to 18s and untreated control and presented as mean ± standard deviation. Unpaired t test was used to evaluate mean differences based on ΔCT values. ***P < 0.001.
Source data are available for this figure.
Source Data for Figure S4[LSA-2020-00875_SdataFS4.xlsx]
- Figure S5. Characterization of mesenchymal stem cell (MSC) exosomes.
(A) Representative nanoparticle tracking analysis plot of MSC exosomes. (B) Representative histogram of flow cytometry analyses of exosomal surface markers (CD9, CD47, CD63, and CD81, indicated in red; isotype control indicated in gray) on MSC exosomes bound to beads. Numbers represent the percentage of positive beads.
Source data are available for this figure.
Source Data for Figure S5[LSA-2020-00875_SdataFS5.xlsx]
- Figure 3. Exosome-mediated delivery of CRISPR/Cas9 inhibits tumor growth in a syngeneic allograft model of pancreatic cancer.
KPC689 cells (106) were implanted subcutaneously into the flank of B6-albino mice. The mice were divided into five treatment groups (n = 8 mice in each group) and injected i.v. and intratumorally (I.T.) every other day for 2 wk. (A) Tumor volume measurements at end point. (B) Body weight of mice at end point. (C) Tumor weight at experimental end point. (D) Tumor burden (tumor weight/body weight) at end point. (E) Expression mRNA levels of intratumoral cas9 assessed by quantitative PCR (normalized to 18s). Statistical analysis was performed based on based on ΔCT values. n = 5 mice per group. (F) Intratumoral synthetic guide RNA assessed by QIAxcel capillary gel electrophoresis. All measurements are expressed as mean ± SEM. Kruskall–Wallis with Dunn’s multiple comparison test performed. *P < 0.05.
Source data are available for this figure.
Source Data for Figure 3[LSA-2020-00875_SdataF3.xlsx]
- Figure S6. Phospho-ERK activation and WT Kras mRNA levels in syngeneic allograft tumor model.
(A) Quantification of phospho-ERK1/2 (normalized to total ERK1/2 and β-actin) as assessed via Western blot. Exo-Fect + KrasG12D synthetic guide RNA1, n = 7 mice; n = 8 mice for all other groups. Data are presented as mean ± SEM. Kruskall–Wallis with Dunn’s multiple comparison test performed. (B) Quantitative PCR for WT Kras mRNA. Data are normalized to 18s and Exosomes + Exo-Fect control and presented as mean ± SEM. n = 5 mice per group. One-way ANOVA with Tukey’s multiple comparison test performed. (C) Full-length blots for phospho-ERK1/2, total ERK1/2, and β-actin. *P < 0.05, **P < 0.01.
Source data are available for this figure.
Source Data for Figure S6[LSA-2020-00875_SdataFS6.xlsx]
- Figure 4. Exosome-mediated delivery of CRISPR/Cas9 reduces tumor growth in an orthotopic model of pancreatic cancer.
KPC689-GFP-Luc+ cells (5 × 105) were orthotopically injected into the pancreas of B6-albino mice at day 0 (D0). The mice were enrolled 3 d post orthotopic tumor implantation, divided into four treatment groups (n = 3–4 mice in each group) and injected i.p. every other day for 3 wk. (A) Tumor growth was tracked with bioluminescent imaging at day 0 (D0), day 11 (D11), day 20 (D20), and day 24 (D24). The bioluminescence was normalized to the photon flux observed D0 and the relative change in bioluminescence is reported. Two-way ANOVA was performed with Tukey’s multiple comparison test to compare differences in the mean at different days/time points among the different groups. (B) Tumor mRNA expression levels of KrasG12D at end point was evaluated with Quantitative PCR. Data are normalized to 18s levels and the Exosomes + Exo-Fect control group. One-way ANOVA with Tukey’s multiple comparisons test was used to evaluate mean differences among groups based on ΔCT values. (C) Tumor mRNA expression levels of cas9 was evaluated with Quantitative PCR. Data are normalized to 18s levels. One-way ANOVA with Tukey’s multiple comparisons test was used to evaluate mean differences among groups based on ΔCT values. (D) Tumor expression level of synthetic guide RNA (∼100 bp) was also confirmed by agarose gel electrophoresis of reverse transcribed cDNA. The data are expressed as mean ± SEM.
Source data are available for this figure.
Source Data for Figure 4[LSA-2020-00875_SdataF4.xlsx]
Tables
sgRNA sgRNA sequence (5′ to 3′) sgRNA1 KrasG12D forward CACCGGTGGTTGGAGCTGATGGCGT sgRNA1 KrasG12D reverse AAACACGCCATCAGCTCCAACCACC sgRNA2 KrasG12D forward CACCGCTTGTGGTGGTTGGAGCTGA sgRNA2 KrasG12D reverse AAACTCAGCTCCAACCACCACAAGC Gene Sequence cas9 forward 5′-GCCAGATCCTGAAAGAACAC-3′ cas9 reverse 5′-TCCTGGTCCACGTACATATC-3′ ACTB forward 5′-CATGTACGTTGCTATCCAGGC-3′ ACTB reverse 5′-CTCCTTAATGTCACGCACGAT-3′ KrasG12D forward 5′-ACTTGTGGTGGTTGGAGCAGA-3′ KrasG12D reverse 5′-TAGGGTCATACTCATCCACAA-3′ WT Kras forward 5′-CAAGAGCGCCTTGACGATACA-3′ WT Kras reverse 5′-CCAAGAGACAGGTTTCTCCATC-3′ 18s forward 5′-GTAACCCGTTGAACCCCATT-3′ 18s reverse 5′-CCATCCAATCGGTAGTAGCG-3′ Primer Sequence KrasG12D synthetic guide RNA1 forward 5′-GTGTGTCCACAGGGTATAGCG -3′ KrasG12D synthetic guide RNA1 reverse 5′-TCTTTTTCAAAGCGGCTGGC -3′ Target protein Host species Dilution Vendor, cat. no. CD81 Mouse 1:1,000 Santa Cruz, sc-166029 Alix Mouse 1:1,000 CST, 2171 β-actin Rabbit 1:1,000 CST, 4970 Calnexin Mouse 1:200 Santa Cruz, sc-23954 RasG12D Rabbit 1:1,000 CST, 14429 p44/42 MAPK (Erk1/2) Rabbit 1:1,000 CST, 9102 Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) Rabbit 1:1,000 CST, 4376 Cas9 Mouse 1:500 Abcam, ab191468 HRP-conjugated β-actin - 1:25,000 Sigma-Aldrich, A3854 Anti-rabbit HRP-conjugated - 1:5,000 CST, 7074 Anti-mouse HRP-conjugated - 1:1,000 R&D, HAF007
In this Issue
Related Articles
Cited By...
- No citing articles found.