A conserved PI(4,5)P2–binding domain is critical for immune regulatory function of DOCK8

Cell culture and transfections

BW5147α⁻β⁻ mouse thymoma cell line (White et al, 1989), and its stable transfectants were maintained in RPMI 1640 medium (FUJIFILM Wako Pure Chemical Corporation) supplemented with 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin (all from Life Technologies).

BW5147α⁻β⁻ cells expressing HA-tagged DOCK8, DOCK8 ΔDHR-1 (residues 561–738 deleted), or KARA mutant were generated by electroporation of the respective pBJ-neo–based construct, and clonal selection with G418 at 2 mg/ml. BW5147α⁻β⁻ cells expressing HA-tagged DOCK2 and FLAG-tagged DOCK8, DOCK8 ΔDHR-1, or KARA mutant were generated by electroporation of the respective pSI-hygro-based construct into BW5147α⁻β⁻ cells expressing HA-tagged DOCK2 (Harada et al, 2012), and clonal selection with hygromycin at 1 mg/ml.

COS-7 cells were maintained in DMEM (FUJIFILM Wako Pure Chemical Corporation) supplemented with 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin.

Protein expression and purification

The genes encoding the mouse DOCK8 DHR-1 domain (residues 558–740) and human PLCδ1 PH domain (residues 1–170) were cloned in pGEX6P-1 vector (GE Healthcare), and expressed as a GST-fusion protein in Escherichia coli ArcticExpress DE3 strain (Agilent Technologies) by induction with 0.5 mM IPTG at 16°C overnight. Protein was purified by affinity chromatography on Glutathione Sepharose 4B beads (GE Healthcare). PCR-directed mutagenesis was used to introduce point mutations in the DOCK8 DHR-1 construct. For ITC experiments, the N-terminal GST-tag was removed by digestion with PreScission protease.

For structural analysis, the gene encoding the DOCK8 DHR-1 domain (residues 556–740) was cloned into the pCR2.1 vector (Invitrogen) with an N-terminal His-tag and a tobacco etch virus protease cleavage site. Selenomethionine (SeMet)-labeled and non-labeled proteins were synthesized by the large-scale dialysis mode of the E. coli cell-free reaction (Terada et al, 2014; Katsura et al, 2017). Each protein was purified by His-tag affinity chromatography. After digestion with tobacco etch virus protease, the protein was further purified by size-exclusion chromatography on a HiLoad 16/60 Superdex 75 pg column (GE Healthcare Life Sciences).

Lipid-binding assays

Lipid vesicles were prepared as follows. Briefly, an equal weight mixture of L-α-phosphatidylcholine (PC;840051P; Avanti) and 3-sn-phosphatidylethanolamine (PE; #P4264; Sigma-Aldrich) supplemented with specified concentrations (w/w) of each diC8-phosphoinositide (Avanti 840150P, 840151P, 840152P, 840153P, 840154P, 840155P, and 840156P) dissolved in chloroform (0.8 mg total lipid in 80–100 μl) were dried with the Speed Vac concentrator (Savant Instruments). Lipids were resuspended in TBS (20 mM Tris–HCl, 0.15 M NaCl, pH 7.5), and incubated in a water bath at 37°C for 30 min. The solution was mixed vigorously by vortex for 10 min to obtain lipid vesicles. Before use, lipid vesicles were precipitated at 20,000g for 5 min, washed twice with TBS, and resuspended with 200 μl of binding buffer (20 mM Tris–HCl, 0.15 M NaCl, 1 mM EDTA, pH 7.5). Lysates of BW5147α⁻β⁻ cells were prepared by resuspending cells in binding buffer supplemented with 0.2% NP-40 and 1 mM PMSF at 2.0 × 10⁶ cells/300 μl, and going through freeze-thawing cycles using liquid nitrogen and water bath at 37°C. Lysates were clarified by centrifugation at 20,000g for 5 min at 4°C. 25 μl of clarified lysates was mixed with 100 μl of lipid vesicles (0.4 mg total lipid) in 1 ml of binding buffer supplemented with 1 mM PMSF, and incubated for 90 min at 4°C on a rotating wheel. Lipid vesicles were pelleted by centrifugation at 20,000g at 4°C, and washed twice with ice-cold binding buffer supplemented with 0.004% NP-40 and 1 mM PMSF. The pellets were mixed with an equal volume of 2× sample buffer (125 mM Tris–HCl, 4% SDS, 20% glycerol, 0.01% bromophenol blue, and 5% mercaptoethanol, pH 6.8), and boiled for 5 min. The fraction associated with lipid vesicles was separated by SDS–PAGE and immunoblotted using anti-HA antibody to detect DOCK8 protein. For the analyses of the isolated DHR-1 domain proteins, lipid vesicles were resuspended with binding buffer supplemented with 0.1% fatty acid free BSA (#A8806; Sigma-Aldrich), and 1 μg of each GST-fusion protein was used with binding buffer supplemented with 0.006% NP-40. When comparing with the PLCδ1-PH domain, PE was replaced with L-α-phosphatidylinositol (PI; #P0639; Sigma-Aldrich) as previously reported (Oikawa et al, 2004).

Crystallization and structure analysis

The SeMet-labeled DOCK8 DHR-1 crystals were grown at 20°C using the hanging-drop vapor diffusion method by mixing the protein solution (12 mg/ml in 20 mM Tris–HCl at pH 8.0, 150 mM NaCl, and 2 mM DTT) with an equal volume of reservoir solution (22% PEG3350 and 0.2 M potassium chloride). The single-wavelength anomalous dispersion (SAD) data were collected at 100 K with a wavelength of 0.9790 Å at BL26B2, SPring-8. Similarly, high-resolution native datasets were collected at a wavelength of 1.0 Å with non-labeled DOCK8 DHR-1 crystals grown with and without 0.84 mM diC8-PI(4,5)P2 (P-4508; Echelon). The crystallization conditions for the non-labeled DOCK8 DHR-1 crystals were 20% PEG3350 and 0.2 M di-sodium hydrogen phosphate in the absence of diC8-PI(4,5)P2, and 20% PEG3350 and 0.2 M sodium sulfate decahydrate in the presence of diC8-PI(4,5)P2. The diffraction data were processed with the HKL2000 program (Otwinowski & Minor, 1997). The structure of DOCK8 DHR-1 was solved by SAD phasing with SHELX (Sheldrick, 2010) and AutoSol (Terwilliger et al, 2009) programs, and the native datasets diffracting to higher resolution were used to refine the model. The model was corrected iteratively using the program Coot (Emsley & Cowtan, 2004) and refined using PHENIX (Adams et al, 2010). The quality of the model was inspected by PROCHECK (Laskowski et al, 1993). Molecular graphics were generated using PyMOL (Delano, 2002).

Modeling

The AutoDock Vina program (Trott & Olson, 2010) was used to perform molecular docking. The structure of DOCK8 DHR-1 crystalized with 0.84 mM diC8-PI(4,5)P2 was used to dock diC8-PI(4,5)P2. Binding poses were searched within a grid box enclosing two critical PI(4,5)P2–binding residues, K576 and R581, in DOCK8. The docked structure was further minimized using the Amber simulation programs (Case et al, 2014). The structure of the DOCK8 DHR-1 R570S mutant was created using Coot, docked with diC8-PI(4,5)P2, and minimized similarly to wild-type DOCK8 DHR-1.

ITC

ITC measurements were carried out on a MicroCal Auto-iTC200 (Malvern Instruments) at 25°C. Each titration was performed with 19 injections of 2 μl aliquots of 1 mM diC8-PI(4,5)P2 or diC8-PI(3,4,5)P3 (both from Echelon Biosciences) at 150 s intervals into a reaction cell containing 62 μM DOCK8 DHR-1 or its mutants. The buffer consisted of 20 mM Tris–HCl (pH 8.0) and 16 mM NaCl. Data were analyzed using the Origin 7 software (OriginLab Corporation).

Immunofluorescence microscopy

Cells were seeded on 35-mm poly-L-lysine-coated glass-bottom dishes (D11131H; Matsunami Glass), and cultured overnight. Then, cells were washed once with PBS, and fixed with 4% paraformaldehyde/PBS. Fixed cells were washed three times with PBS, and incubated with Alexa Fluor 488–conjugated WGA (final 3–10 μg/ml, W11261; Invitrogen) for 10 min at RT. Cells were permeablilized for 5 min with 0.1% Triton-X-100/PBS, and blocked with 1% BSA/PBS for 1 h at RT. Cells were incubated with anti-HA antibody (1:5,000, clone 3F10; Roche) for 1 h at RT, and with Alexa Fluor 546–conjugated goat anti-rat IgG antibody (1:2,000, A11081; Invitrogen) for 1 h at RT. Cells were then stained with DAPI (1:5,000; WAKO), and mounted using the fluorescent mounting medium (DAKO). Images were taken with a confocal laser scanning microscope FV3000 (Olympus Corporation) using a UPlanSApo 60×/1.35 na oil immersion objective lenz (Olympus Corporation). For quantification of colocalization, images were analyzed by the line profile function of the built-in cellSens application. For each cell, a well-defined area of cytoplasm to plasma membrane was identified, and intensity profile along a single traverse line was obtained. Points with peak fluorescence intensity of WGA staining on both ends of the cell periphery were defined as the PM, and set as zero distance, and intensity profile of HA-staining over 1.1 μm from PM were analyzed.

Subcellular fractionation

BW5147α⁻β⁻ cells (1 × 10⁷ cells) were resuspended in 700 μl of ice-cold hypotonic buffer (42 mM KCl, 10 mM Hepes [pH 7.4], 5 mM MgCl₂) supplemented with 1× complete protease inhibitor cocktail (Roche), and incubated on ice for 15 min. Cells were transferred to a 1 ml syringe, and sheared by passing through a 27 gauge neddle five times. The lysates were centrifuged at 200g for 10 min to remove nuclei and cell debris. Then, the lysates were centrifuged at 13,000g for 60 min at 4°C, and the supernatant was collected as the “cytoplasmic fraction.” The pellet was resuspended in lysis buffer (20 mM Tris–HCl [pH 7.5], 150 mM NaCl, 1% NP-40) supplemented with 1× complete protease inhibitor cocktail, and detergent-extracted by vortexing, and incubating on a rotating wheel for 45 min at 4°C. Then, the sample was centrifuged at 13,000g for 60 min at 4°C, and the supernatant was collected as the “membrane fraction.”

FRET imaging

Live cell imaging with a FRET-based biosensor Raichu-Cdc42 was used to measure Cdc42 activity in living cells (Aoki & Matsuda, 2009). COS-7 cells were seeded in 60 mm dishes, and transfected with 0.5 μg of the Raichu-Cdc42 expression plasmid (1054X) and 4.5 μg of pBJ-neo or the respective DOCK8 construct using Lipofectamine 2000 transfection reagent (Invitrogen). 16 h after transfection, the cells were reseeded onto fibronectin (F1141; Sigma-Aldrich)-coated 35-mm glass-bottom dishes (D11130H; Matsunami Glass). The culture medium was replaced with fresh phenol red-free RPMI 1640 medium (Gibco) supplemented with 20 mM Hepes (pH 7.3) before microscopic analysis. FRET imaging was performed on the Olympus IX-81 fluorescence microscope equipped with an ORCA-Flash 4.0 digital CMOS camera (Hamamatsu) and a UPlanSApo 60×/1.35 na oil immersion objective lenz (Olympus Corporation) in a dark room warmed at 30°C. The culture dishes were placed on a heated stage set at 37°C, and kept for 2 min before imaging for 5 min with 30 s intervals with excitation using an LED illumination precisExcite fluorescence excitation system (CoolLED), excitation filter 440AF21 (Omega), and a 455DRLP dichroic mirror (Omega), and emission filter 480AF30 (Omega) with exposure time 250 ms for CFP (excitation at 480 nm), and emission filter 535AF26 (Omega) with exposure time 500 ms for YFP (reporting FRET; excitation at 555 nm). Using the MetaMorph software, background was subtracted from each stack of the raw CFP and YFP images. The average intensity of CFP and YFP in the whole area of transfected cells was measured, and the values of YFP to CFP emission ratio over 2–5 min were averaged, and normalized to the values of control cells (transfected with pBJ-neo) in each experiment.

Immunoblotting analysis

Immunoblotting was performed with following antibodies: rat monoclonal antibody for HA (1:2,000 dilution, 3F10; Roche), anti-GST antibody (1:500, 013-21851; Wako), rabbit anti-GFP antibody (1:1,000, A11122; Invitrogen), mouse anti-Cdc42 antibody (1:1,000, 05-542; Millipore), rabbit anti-LAT antibody (1:1,000 06-807; Millipore), HRP-conjugated rabbit anti-FLAG (DDDDK-tag) antibody (1:2,000, PM020-7; MBL), custom-made rabbit anti-DOCK8 antibody (1:1,000; Harada et al, 2012), goat anti-actin (1:1,000, sc-1616; Santa Cruz), and corresponding species-specific HRP-conjugated anti-IgG antibodies (1:2,000; all from Santa Cruz). Blots were developed on Super RX X-ray films (Fujifilm) with the ECL or ECL Prime western blotting detection reagents (GE Healthcare).

Mice

All mice were on genetic background of C57BL/6J strain (CLEA Japan). DOCK8 null mice were described previously (Harada et al, 2012). Mice harboring K576A/R581A mutation in DOCK8 were generated by CRISPR/Cas9–mediated genome editing as described below. Mice were maintained under specific pathogen-free conditions in the animal facility of Kyushu University. The protocol of animal experiments was approved by the committee of Ethics on Animal Experiments, Kyushu University.

CRISPR/Cas9–mediated genome editing in mouse pronuclear zygote

A custom-designed DOCK8 locus-specific crRNA (5′-GCUGGGGGUAUACGUACAGAGUUUUAGAGCUAUGCU-3′; Target guide RNA sequence on the DOCK8 exon 15 underlined; Integrated DNA Technologies) was made into duplex with the generic tracrRNA (#1072532; Integrated DNA Technologies) in Nuclease-Free Duplex Buffer (30 mM Hepes, pH 7.5, 100 mM potassium acetate). 60 pmol of the duplex guide RNA was incubated with 6 μg of Cas9-3NLS protein (Integrated DNA Technologies) in 1× Opti-MEM (Thermo Fisher Scientific) for 10 min at RT to form a Cas9-guide RNA (RNP) complex, then followed by addition of 180 pmole of single-stranded donor oligo (5′-CTTACCGGCATAGCATTGCTGGGGTCTTCTCCGCACATAAACTGAATCTTTATTGTGATGTTCGCGGCAGATGCTAGCGCGCTAGCGAAGTTCAGTCGCTGGGGG TAGACATACAGAAGGTTTCTGGAAAAGAGAGAGACCAATGATCAACAGATGATG TCTGGAGTTCACTTCGGCTTT-3′; mutations corresponding to K576A/R581A, double-underlined; silent mutations blocking Cas9 re-cutting, underlined) as a template for homology-directed DNA repair. Mouse pronuclear-stage embryos were obtained by the standard in vitro fertilization method from C57BL/6J donors (CLEA Japan). At 7 h from insemination, the Cas9 RNP complex and donor oligo were transferred to intact pronuclear-stage embryos using a NEPA 21 super electroporator and 5 mm-gap platinum metal electrode (NEPA Gene). Set parameters were as follows. Poring pulse: voltage 225 V, pulse length 2 ms, pulse interval 50 ms, number of pulses +4, and decay rate 10%. Transfer pulse: voltage 20 V, pulse length 50 ms, pulse interval 50 ms, number of pulses ± 5, and decay rate 40%. The embryos were cultured overnight, and two-cell stage embryos were selected and transferred to ICR host female mice (Charles River Laboratories). To identify correctly targeted founder mice, the DOCK8 locus spanning exon 15 was amplified by PCR and their sequence was verified. The founder mice were crossed with C57BL/6 males to obtain progenies with transmitted locus.

Preparation of DCs

To generate BM-derived DCs, BM cells were cultured for 7 d with granulocyte-macrophage colony-stimulating factor (GM-CSF; 10 ng/ml; PeproTech), and purified with anti-CD11c microbeads (130-108-338; Miltenyi Biotec). Purified DCs were treated with LPS (200 ng/ml; Sigma-Aldrich) for 24 h for maturation before assays.

3D-cell migration assays

For DCs, 3D collagen gel chemotaxis assays were performed with μ-Slide Chemotaxis3D (ibidi; Harada et al, 2012). Cells were mixed with 1.65 mg/ml of collagen type I (354236; Corning) in phenol red-free RPMI 1640 (11835-030; Gibco) supplemented with 4% FBS, and cast in the central chamber. After polymerization of the lattice, the media with or without mouse CCL21 (10 μg/ml, 457-6C-025; R&D Systems) were added to the wells on either side of the chamber to form a gradient between them. Images were taken in a heated chamber every 2 min using an IX-81 inverted microscope (Olympus Corporation) equipped with a cooled CCD camera (CoolSNAP HQ; Roper Scientific), an IX2- ZDC laser-based autofocusing system (Olympus Corporation), and an MD-XY60100T-Meta automatically programmable XY stage (Sigma KOKI). Images were imported as stacks to ImageJ Version 1.410 software and analyzed with the manual tracking and the chemotaxis and migration tools to measure the migration speed, directionality, and forward migration index. Migration of BW5147α⁻β⁻ cells was analyzed by placing collagen-cell mixture on 35-mm glass-bottomed microwell dishes (P35G-0-10-C; MatTek), followed by incubation in phenol red-free RPMI supplemented with 10% FBS. Images were taken, and velocities were calculated with the manual tracking feature in MetaMorph software.

Reverse transcription-qPCR

Total RNA was isolated from LPS-stimulated DCs using ISOGEN reagent (Nippon Gene), and treated with RNase-free DNase I (Invitrogen). RNA samples were reverse transcribed with oligo(dT)-20 primers (TOYOBO) and Superscript III reverse transcriptase (Invitrogen). Real-time quantitative PCR was performed on a CFX Connect real-time system (Bio-Rad) using the SYBR Green PCR Master Mix (Applied Biosystems) with primers: Ccr7-forward: CCCAGAGCACCATGGACCC, and Ccr7-reverse: CTCGTACAGGGTGTAGTCCACC; and Gapdh forward: GGAGAAACCTGCCAAGTATGATG, and Gapdh reverse: AAGAGTGGGAGTTGCTGTTGAAG. Expression of Ccr7 was normalized to the expression of Gapdh for each sample.

Flow cytometry

LPS-stimulated DCs were preincubated with rat anti-CD16/32 (FcγIII/II receptor; 1:1,000, 2.4G2; TONBO Biosciences) for 10 min on ice to block Fc receptors, and then stained with PE-conjugated rat anti-mouse CCR7 (1:10, 4B12; BioLegend) or PE-conjugated isotype-matched control antibody (rat IgG2a, κ; 1:10, RTK2758; BioLegend) for 30 min at 37°C. Flow cytometric analyses were performed on a FACS Calibur (BD Biosciences).

Cell viability in collagen gels

LPS-stimulated DCs were mixed with collagen type I (0, 1.65, and 3.3 mg/ml) in phenol red-free RPMI 1640 supplemented with 4% FBS, seeded in 24-well plates, and incubated for 30 min at 37°C to solidify the gel. Then, cells were overlaid with the media containing CCL21 at 10 μg/ml to let undergo random migration for 60 min at 37°C. Then, cells were recovered from the gels by incubating with 0.1% collagenase type I. Cells were stained with propidium iodide (PI) and FITC-conjugated Annexin V, and analyzed by flow cytometry for early apoptotic (PI⁻, Annexin V⁺) and late apoptotic cells (PI⁺, Annexin V⁺).

In vivo DC migration assays

LPS-stimulated DOCK8^WT/− DCs and DOCK8^KARA/− or DOCK8^−/− DCs were labeled with PKH26 and PKH67 fluorescent dyes (Sigma-Aldrich), respectively, resuspended in 5 × 10⁵ cells in 20 μl, and mixed at 1:1. Total one million cells in 40 μl were injected subcutaneously into the hind footpads of C57BL/6 mice. After 48 h, cells were recovered from the popliteal LNs, and analyzed by flow cytometry on a FACSVerse (BD Biosciences).

Statistical analyses

Data were examined for normal distribution by a Kolmogorov-Smirnov test using the built-in function of GraphPad Prism 7 software. Parametric data were analyzed by a two-tailed unpaired t test, and nonparametric data were analyzed by a two-tailed unpaired Mann–Whitney test. P < 0.05 was considered statistically significant. P < 0.01 was indicated by **.