Article Figures & Data
Figures
- Figure 1. BCR expression boosts B lymphoma fitness but is not absolutely required for survival.
(A) Cells were stained with anti-IgM and anti-IgD to examine cell surface expression of the BCR. Anti-CD19 was used as a control. (B) Expression of the μ-heavy chain, λ-light chain, Igα, and Igβ were determined by Western blot. One of three independent experiments is shown. (C) The cells were plated on d0 and cell numbers were assessed on d1, d2, and d3 using the CCK8-kit. Values were normalized to the measurement obtained on d1. Significance was determined using the ANOVA test. (D) Expression of the indicated proteins was determined by Western blot. One of four independent experiments is shown. (E) Forward scatter (FSC-A) as a measure of cell size was determined using flow cytometry. Significance was determined using the Mann–Whitney test. N = 8. (F) Biological triplicates of Ig heavy chain–deficient DG75 cells were sorted on d3 upon Ig heavy chain deletion and pooled for analysis. Expression of the Ig heavy chain (antibody directed against the CH domain) and histone 3 (H3) was determined by Western blot. One of two independent experiments is shown. (G) Cell size measured on d6 after Ig heavy chain deletion. Significance was determined using the paired t test. N = 3; **P = 0.0074. (H) Relative abundance of WT and H-KO DG75 cells in a mixed culture at the indicated time points after Ig heavy chain deletion. Linear regression analysis was performed. Slopes of the WT and KO abundance lines were found to be significantly different. P < 0.0001. Circles represent results from independent experiments. (A, B, C, D, E, F, G, H) KO, BCR-KO Ramos cells (A, B, C, D, E), or H-KO DG75 cells (F, G, H) WT, wild-type cells of the corresponding cell line.
- Figure S1. BCR-deficient B lymphoma cells are more sensitive to mTORC1 inhibition.
(A) WT and KO cells were plated on d0 with or without rapamycin, and cell numbers were assessed on d1 and d2 using the CCK8-kit. Values were normalized to the measurement obtained on d1. Significance between WT and KO-and rapamycin-treated and untreated samples on d2 and d3 was determined using the unpaired two-tailed t test. N = 5; *P = 0.0223 and 0.0373, **P = 0.0021 and 0.0074, ***P = 0.0004 ****P < 0.0001. (B) To determine the protein content, cells were loaded with the dye eFluor670 and analyzed by flow cytometry. Significance was determined using the Mann–Whitney test. N = 6. Circles represent independent experiments. gMFI, geometric mean fluorescence intensity; KO, BCR-deficient Ramos cells; WT, Ramos wild-type cells.
- Figure S2. The loss of the BCR has broad effects on cell metabolism.
(A, B, C, D) Global metabolic profiles of WT and KO Ramos cells were determined using UPLC-MS/MS (Metabolon). (A, D) Shown are cell count–normalized results for lipid and glutamine metabolism (A) and NAD+ (D). Welch’s two-sample t test was used to determine statistical significance. N = 4; *P < 0.05. Whisker plots show minimum and maximum values, the box extends from the 25th to the 75th percentile, and the line shows the median. Metabolomic studies shown in Figs 3K, 7F, S2A and D, and S6B and C were performed in parallel and can be, thus, compared directly. (B) Pixel-based fluorescence lifetime microscopy phasor plots of NAD(P)H of untreated WT cells (left) and WT cells treated with the complex I inhibitor rotenone (right). (C) Pixel-based fluorescence lifetime microscopy phasor plots of NAD(P)H corresponding to the fluorescence lifetime images in Fig 2B. WT cells are shown in the left and BCR-deficient cells are shown on the right. Color gradient indicates absolute pixel frequencies of fluorescence lifetimes of various mixtures of free and enzyme-bound NAD(P)H within the cells. The regions of enzyme-bound (enzy.) and free NAD(P)H (free), respectively, are represented on the half-circle. 3-HOC, 3-hydroxyoleoylcarnitine; 3-HPC, hydroxypalmitoylcarnitine; 4-OH-Glu, 4-hydroxyglutamate; α-KGM, α-ketoglutamarate; β-CG, β-citrylglutamate; C14, myristoylcarnitine; C16, palmitoylcarnitine; C18, stearoylcarnitine; C18:1, oleoylcarnitine; C20, arachidoylcarnitine; GABA, carboxyethyl-GABA; GlcNAc, N-acetylglutamine; Gln, glutamine; Glp, pyroglutamine; Glu, glutamate; Glu (OMe)-OH, glutamate, γ-methyl ester; KO, BCR-KO Ramos cells; NAG, N-acetylglutamate; NAAG, N-acetyl-aspartyl-glutamate; P5C, S-1-pyrroline-5-carboxylate; (R)-3-HBC, (R)-3-hydroxybutyrylcarnitine; (S)-3-HBC, (R)-3-hydroxybutyrylcarnitine; WT, Ramos wild-type cells.
- Figure 2. Glycolytic flux is not affected by the absence of the BCR.
(A) NAD(P)H fluorescence lifetime images of WT and KO cells, representative for two experiments. Color gradient indicates NAD(P)H fluorescence lifetime (ps). Scale bar indicates 50 μm. (B) The NAD(P)H fluorescence lifetimes averaged over single cells. Significance was determined using the Mann–Whitney test. ***P < 0.001. The error bars represent SD values. Results representative for two independent experiments. (C) Cell-based phasor plot of 941 KO cells and 526 WT cells out of two independent experiments is shown. For reference, color-encoded phasor coordinates representative for pure free NAD(P)H and for NAD(P)H bound to various pure enzymes are depicted on the half circle (the color coding is explained in the table, together with the corresponding fluorescence lifetimes). Dotted lines represent possible combinations of free and enzyme-bound NAD(P)H. (D) Cells were incubated with 2NBDG for 5 and 30 min. Glucose uptake was determined by flow cytometry. The difference between 30 and 5 min was calculated to determine the rate of glucose uptake over time. Paired two-tailed t test was used to determine statistical significance. N = 4; **P = 0.002, 0.0034, and 0.0029; gMFI, geometric mean fluorescence intensity. (E) Cells were resuspended in glucose-free medium containing glutamine. ECAR was measured using Seahorse flux technology. The measurement was performed in technical triplicates and is displayed as mean ± SD. One of five independent experiments is shown. a, glucose; b, oligomycin; c, 2DG. (E, F) Summary of the experiments performed in (E). Unpaired t test was used to determine significance. GC, glycolytic capacity. (G) Cells were plated on d0 with or without 2DG and cell numbers were assessed on d1 and d2 using the CCK8-kit. Values were normalized to the measurement obtained on d1. Differences observed on d2 were tested for significance using the ANOVA test. N = 4; ***P = 0.0003 and 0.0005. Circles represent independent experiments. (E) For experiments in which technical replicates were measured in parallel (E), a circle represents the mean value of these replicates. KO, BCR-KO Ramos cells; WT, Ramos wild-type.
- Figure 3. BCR ablation leads to impaired mitochondrial function and reduced metabolic flexibility.
(A) WT and BCR-KO Ramos cells were resuspended in medium containing pyruvate, glutamine, and glucose, and oxygen consumption rate (OCR) was measured using Seahorse flux technology. The measurement was performed in technical duplicates (WT) or triplicates (KO) and is displayed as mean ± SD. One of 10 experiments is shown. a, oligomycin; b, FCCP; c, rotenone + antimycin. (A, B) Summary of the experiments performed in (A). Paired two-tailed t test was used to determine significance. N = 10, *P = 0.0136, **P = 0.0011. Max, maximal oxygen consumption; SRC, spare respiratory capacity. (C) Oxygen consumption of WT and H-KO DG75 cells. (A) Experiments were performed as in (A). The experiment was performed in eight technical replicates and is displayed as mean ± SD. The experiment is representative for three independent experiments. (D) Cells were permeabilized with saponin, OCR was measured over time. a, pyruvate + malate; b, ADP; c, oligomycin; d, rotenone + antimycin. One of five independent experiments is shown. (D, E) Summary of experiments performed in (D). Significance was determined using a two-tailed paired t test. *P = 0.0352. (F) Untreated and oligomycin-treated cells were loaded with H2DCFDA and analyzed by flow cytometry. One of five independent experiments is shown. (F, G) Difference between untreated and oligomycin-treated cells stained for reactive oxygen species as shown in (F) was calculated. Paired two-tailed t test was used to determine statistical significance. N = 5; *P = 0.016. (H) Flow cytometric analysis of Mito Tracker Red-CMXRos–stained WT and KO cells. Significance was determined using the Mann–Whitney test. N = 5. (I, J) WT and KO Ramos cells were cultured overnight with or without oligomycin. Cell death was determined using 7-AAD. (I, J) A representative experiment is shown in (I), summary of the performed experiments is shown in (J). Statistical significance was determined using the ANOVA test. N = 7; ****P < 0.0001. (K) WT and BCR-KO cells were treated overnight with oligomycin. Global metabolic profiles were determined using UPLC-MS/MS (Metabolon). Shown are cell count–normalized results for glucose and glucose-6-phosphate (G6P). Welch’s two sample t test was used to determine statistical significance. N = 4; *P < 0.05. Whisker plots show minimum and maximum values, the box extends from the 25th to the 75th percentile, the line shows the median. Metabolomic studies shown in Figs 3K, 7G, S2A and D, and S6C and D were performed in parallel and can be, thus compared directly. Circles in the shown graphs represent independent experiments. (A, C) For experiments in which technical replicates were measured in parallel (A, C) a circle represents the mean value of these replicates. (A, B, C, D, E, F, G, H, I, J, K) KO, BCR-KO Ramos cells (A, B, D, E, F, G, H, I, J, K), or Ig heavy chain–deficient DG75 cells (C), WT, corresponding wild type cells. gMFI, geometric mean fluorescence intensity.
- Figure S3. BCR ablation leads to reduced metabolic flexibility.
(A) Pictures show Mito Tracker Red-CMXRos staining alone (upper panels) and overlaid with transmitted light (lower panels) of WT and KO cells (magnification 63×, scale bar = 5 μm). (B) Cells were plated on d0 with or without oligomycin and cell numbers were assessed on d1 and d2 using the CCK8-kit. Values were normalized to the measurement obtained on d1. Statistical significance was determines using the ANOVA test. N = 7; *P = 0.0213 and 0.0341, **P = 0.0012. (C) Cells were left untreated or incubated with oligomycin overnight. Cells were resupsended in medium containing pyruvate, glutamine, and glucose, and OCR was measured using Seahorse flux technology. One of three independent experiments is shown. a, oligomycin, b, FCCP, c, rotenone + antimycin. (D) Cells were cultured in glucose free RPMI+ dialyzed FBS in the presence of 10 mM glucose, 10 mM galactose, or 10 mM GlutaMAX with or without oligomycin. Cell numbers were assessed using the CCK8 kit after overnight incubation. Results are normalized to the values obtained from the untreated sample cultured with glucose. Differences between the indicated pairs of samples were tested for significance using the unpaired t test. N = 3; *P = 0.0242, **P = 0.0033 and 0.0059, ***P = 0.0005 and 0.0002. KO, BCR-KO Ramos cells; WT, Ramos wild-type cells.
- Figure S4. Syk-deficient cells show impaired anti-IgM induced signaling.
(A, B) Expression of the indicated proteins was determined by Western blot. Actin and GAPDH served as loading control. KO, BCR-KO Ramos cells; Syk−/−, Syk-deficient Ramos cells; WT, Ramos wild-type cells.
- Figure 4. Syk-dependent BCR signaling is dispensable for metabolic adaptations in lymphoma B cells.
(A) Expression of the indicated proteins was determined by Western blot. Actin served as a loading control. One of three independent experiments is shown. (B) Cells were resuspended in medium containing pyruvate, glutamine, and glucose, and OCR was measured using Seahorse flux technology. The measurements were performed in technical triplicates and are displayed as mean ± SD. One out of two independent experiments is shown. a, oligomycin; b, FCCP; c, rotenone + antimycin. (C) Cells were stained with H2CFDA to detect reactive oxygen species. One of two independent experiments is shown. (D) Cells were cultured overnight with or without oligomycin. Cell death was determined using 7-AAD. Significance was determined using the ANOVA test. For clarity, only comparisons between KO and WT or Syk-KO cells are shown. N = 4, ***P = 0.004, ****P < 0.0001. (E) Cells were loaded with Indo-1 AM. Basal calcium levels were measured for 60 s. Cells were stimulated with pervanadate. Circles represent independent experiments. KO, BCR-KO Ramos cells; Syk-KO, Syk-deficient Ramos cells; WT, Ramos wild-type.
- Figure 5. ER expansion and function are impaired in BCR-KO B lymphoma cells.
(A) Pictures show ER-Tracker Green stained cells alone (left panels) and overlaid with transmitted light (right panels) of WT and KO cells (magnification 63×, scale bar = 5 μm). (B, C) Ramos cells stained with ER-Tracker Green were analyzed by flow cytometry. (B, C) A representative experiment is shown in (B), and summary of four independent experiments is shown in (C). Significance was determined using unpaired t test. N = 4; ***P = 0.0004. (D, E) Cells were left untreated (UT) or were treated with the chemical chaperone 4-sodium phenyl butyrate (SPB) and the ER stress–inducing agents tunicamycin or thapsigargin overnight and assayed for the expression of the indicated proteins. Actin was used as a loading control. One of two independent experiments is shown. (F) DG75 cells were stained with ER-Tracker Green at day 6 after Ig heavy chain deletion. Significance was determined using the paired t test *P = 0.0262. (G) mRNA levels of the indicated genes in DG75 cells were analyzed on day 6 after Ig heavy chain deletion. (H) N = 6; (H) sXbp1 protein levels as determined by flow cytometry in single cell clones derived from DG75 cells. Significance was determined using the t test. N = 3; *P = 0.033. (I) Expression of the indicated proteins in DG75 single cell clones. Antibodies directed against the CH region and the Fab region of IgM were used. (J) Cells were loaded with Indo-1 AM and incubated with EGTA. Basal calcium levels were measured for 60 s. The cells were stimulated with thapsigargin. The ratio of bound/unbound Indo1 is shown. One of three experiments is shown. Circles represent independent experiments. (G) For experiments in which technical replicates were measured in parallel (G), a circle represents the mean value from these replicates. (A, B, C, D, E, F, G, H, I, J) KO, BCR-KO Ramos cells (A, B, C, D, E, J) or H-KO DG75 cells (F, G, H, I); WT, wild-type cells.
- Figure 6. Mitochondrial calcium and ACL activation are reduced in BCR-KO Ramos cells.
(A) Cells were stained with Rhod-2-AM to assess mitochondrial calcium and analyzed by flow cytometry. One of six independent experiments is shown. (B) Cells were incubated with or without BAPTA-AM for 1 h and 30 min, and oxygen consumption was measured. The measurements were performed in technical triplicates and are displayed as mean ± SD. One of three independent experiments is shown. a, oligomycin; b, FCCP; c, rotenone + antimycin. (C) ACL phosphorylation was analyzed by Western blot. Actin was used as a loading control. One of four independent experiments is shown. (D) Cells were left untreated or were treated with rotenone or rotenone + pyruvate overnight. Cell death was determined by 7-AAD incorporation. One of six independent experiments is shown. KO, BCR-KO Ramos cells; WT, Ramos wild-type cells.
- Figure S5. ACL expression is decreased in BCR-deficient Ramos cells.
(A) Cells were incubated with or without BAPTA-AM for 1 h and 30 min and ECAR was measured. The measurements were performed in technical triplicates and are displayed as mean ± SD. One of three experiments is shown. a, glucose, b, oligomycin, c, 2DG. (B) Cells were treated with BAPTA-AM for 1 h or overnight, and cell death was determined using flow cytometry. (C) Expression of ACL was determined by Western blot. GAPDH served as loading control. One of three independent experiments is shown. KO, BCR-deficient Ramos cells; WT, Ramos wild-type cells.
- Figure S6. Expression of immunoglobulin heavy- and light-chain induces broad changes in cell metabolism.
(A) Basal calcium levels of Ramos cells expressing a NIP specific BCR (left) and BCR-KO + mIgM cells (right) were measured for 60 s, and cells were stimulated with NIP-BSA or anti-IgM. (B, C) Global metabolic profiles of WT and KO + mIgM Ramos cells were determined using UPLC-MS/MS (Metabolon). (B, C) Shown are cell count–normalized results for lipid (B) and glutamine (C) metabolism. Welch’s two-sample t test was used to determine statistical significance. N = 4; *P < 0.05. Whisker plots show minimum and maximum values, the box extends from the 25th to the 75th percentile, and the line shows the median. Metabolomic studies shown in Figs 3K, 7F, S2A and D, and S6B and C were performed in parallel and can be, thus, compared directly. α-KGM, α-ketoglutamarate; β-CG, β-citrylglutamate; 3-HOC, 3-hydroxyoleoylcarnitine; 3-HPC, hydroxypalmitoylcarnitine; 4-OH-Glu, 4-hydroxyglutamate; C14, myristoylcarnitine; C16, palmitoylcarnitine; C18, stearoylcarnitine; C18:1, oleoylcarnitine; C20, arachidoylcarnitine; GABA, carboxyethyl-GABA; GlcNAc, N-acetylglutamine; Gln, glutamine; Glp, pyroglutamine; Glu, glutamate; Glu (OMe)-OH, glutamate, γ-methyl ester; KO, BCR-deficient Ramos cells; KO + mIgM, BCR-deficient Ramos cells reconstituted with mIg heavy and light chain; NAG, N-acetylglutamate; NAAG, N-acetyl-aspartyl-glutamate; P5C, S-1-pyrroline-5-carboxylate; (R)-3-HBC, (R)-3-hydroxybutyrylcarnitine; (S)-3-HBC, (R)-3-hydroxybutyrylcarnitine; WT, Ramos wild-type cells.
- Figure 7. Immunoglobulin induced ER stress leads to increased oxygen consumption and metabolic flexibility.
(A) FSC-A as a measure of cell size was determined by flow cytometry. One of two experiments is shown. (B) Cells were assessed for the expression of the indicated proteins. MEK1/2 is used as loading control. One of three independent experiments is shown. (C) Cells were resuspended in medium containing pyruvate, glutamine, and glucose, and OCR was measured using Seahorse flux technology. The measurements were performed in technical triplicates and are displayed as mean ± SD. One of four independent experiments is shown. a, oligomycin; b, FCCP; c, rotenone + antimycin. (C, D) Summary of basal oxygen levels measured in experiments described in (C). Statistical significance was determined using the paired t test. N = 4; *P = 0.0442, **P = 0.0094. (E) Cells were resuspended in glucose-free medium containing glutamine, and ECAR was measured using Seahorse flux technology. The measurements were performed in technical triplicates and are displayed as mean ± SD. One of two independent experiments is shown. a, glucose; b, oligomycin; c, 2DG. (F) Global metabolic profiles of WT, KO, and KO + mIgM Ramos cells were determined using UPLC-MS/MS (Metabolon). Shown are cell count normalized results for NAD+. WT and KO results are the same samples as shown in S2D. Welch’s two sample t test was used to determine statistical significance. N = 4; *P < 0.05. Whisker plots show minimum and maximum values, the box extends from the 25th to the 75th percentile, and the line shows the median. Metabolomic studies shown in Figs 3K, 7F, S2A and D, and S6B and C were performed in parallel and can be, thus, compared directly. (G) Cells were left untreated or were treated with oligomycin or rotenone overnight. Cell death was determined by 7-AAD incorporation. Significance was determined using the ANOVA test. For clarity, only comparisons of KO versus WT or KO + mIgM are shown. N = 4, *P = 0.0311, **P = 0.0021, ****P < 0.0001. (H) BiP expression was determined by Western blot. Shown is one of two experiments. (I) Cells were resupsended in medium containing pyruvate, glutamine, and glucose, and OCR was measured using Seahorse flux technology. One of two independent experiments is shown. a, oligomycin; b, FCCP; c, rotenone + antimycin. (J) Cells were cultured overnight with or without oligomycin. Cell death was determined using 7AAD. N = 6, **P = 0.0022 and 0.0028. Statistical significance was determined using the ANOVA test. For simplicity, only comparisons of WT and KO cells and of KO + sIgM and KO cells are shown. Circles represent independent experiments. (C, E, I) For experiments in which technical replicates were measured in parallel (C, E, I), a circle represents the mean value of these replicates. KO, BCR-KO Ramos cells; KO + mIgM, BCR-KO Ramos cells reconstituted with Ig heavy and light chain; KO + sIgM, KO cells reconstituted with the secreted version of IgM; WT, Ramos wild-type cells.
- Figure 8. Immunoglobulin expression is needed for ER maintenance in resting B cells.
(A) Mature resting B cells from B1-8flox (B18f) and B1-8flox × R26Stopflox P110* (B18f P110*) mice were treated with TAT-Cre to induce the deletion of loxP-flanked sequences. The frequency of BCR-negative B cells was monitored over time. (B) Cell size of B1-8flox × Mb1-creERT2 B cells treated with tamoxifen to induce the deletion of the Ig heavy chain. (B, C) Cell size (B) and ER mass (C) of cells positive for surface IgM (IgM+) and negative for surface IgM (IgM−) was determined on day 3. Data were tested for significance using the paired t test. (A, B) N = 3; P = 0.75 (A), **P = 0.0087 (B). Experiments were performed in six technical replicates. Circles indicate mean values of these replicates obtained from three different mice. (D) Mature resting B cells from B1-8flox × EµBcl2 mice treated with TAT-Cre to induce the deletion of the Ig heavy chain, FACS-sorted on d5 upon TAT-Cre, and let to recover for 24 h post-sorting were resuspended in medium containing pyruvate, glutamine, and glucose, and OCR was measured using Seahorse flux technology on d6. The measurements were performed in technical triplicates and are displayed as mean ± SD. a, oligomycin; b, FCCP; c, rotenone + antimycin. (E) mRNA levels for the indicated genes were determined on day 2 after TAT-Cre–mediated deletion of loxP-flanked sequences in B18f and B18f P110* B cells positive or negative for surface IgM expression. Results were tested for significance using two-way ANOVA. For clarity, only differences between IgM+/IgM− and IgM+ P110*/IgM− P110* cells are shown. **P = 0.0078 and 0.0057, *P = 0.0351 and 0.0402. Graph shows data obtained from three mice. (F, G, H) B cells from B1-8flox × EµBcl2 mice were purified, treated with TAT-Cre, kept for 4–6 d in culture to allow for IgM deletion, and stimulated overnight with LPS. (F, G, H) BiP protein levels (F), cell size (G), and CD69 surface levels (H) were assessed by flow cytometry. Results were tested for significance using ANOVA. For clarity only differences between IgM+ and IgM− cells are shown. Circles represent data obtained from different mice. If samples were measured in technical replicates, circles represent mean values obtained from these replicates. For F: N = 7, **P = 0.002; for G: N = 4, ***P = 0.0006; for H: N = 5, *P = 0.0192. Heavy chain deletion was performed in an in vitro cell culture in the presence of the cytokine BAFF.
Tables
Primer sequences.
Primer sequence Mouse H3_F GTGAAGAAACCTCATCGTTACAGGCCTGGT H3_R CTGCAAAGCACCAATAGCTGCACTCTGGAA Rplp0_F TTCATTGTGGGAGCAGAC Rplp0_R CAGCAGTTTCTCCAGAGC BiP (Hspa5)_F TTCAGCCAATTATCAGCAAACTCT BiP (Hspa5)_R TTTTCTGATGTATCCTCTTCACCAGT Edem_F CTACCTGCGAAGAGGCCG Edem_R GTTCATGAGCTGCCCACTGA β-actin_F GGCTGTATTCCCCTCCATCG β-actin_R CCAGTTGGTAACAATGCCATGT Human BiP_F TCCTATGTCGCCTTCACT BiP_R ACAGACGGGTCATTCCAC GAPDH_F CCAGGTGGTCTCCTCTGACTT GAPDH_R GTTGCTGTAGCCAAATTCGTTGT DNAJB1_F GACCCTCATGCCATGTTTGC DNAJB1_R CCCATAGGGAAGCCAGAGAAT DNAJC12_F GAATGTCACCCAGACAAGC DNAJC12_R GAATGGCATCGACATCTG
