CDKL3 promotes osteosarcoma progression by activating Akt/PKB

Cell culture

Saos-2 and U2OS cells were purchased from the cell bank of Shanghai Biology Institute, Chinese Academy of Science. HEK293T cells were provided by Shanghai Tumor Research Institute. 293T and Saos-2 cells were grown in DMEM medium (Biowest) supplemented with 10% fetal bovine serum (Biowest). U2OS cells were grown in RPMI 1640 medium (Biowest) with 10% fetal bovine serum (Biowest).

High-content screening for cell growth

Saos-2 cells were seeded at a density of 2,000 cells/well in a 96-well plate, and the cell growth was then monitored once a day for 5 d after shRNA transduction using the Cellomics ArrayScanV high-content image platform and calculated by HCS Studio Cell Analysis Software (Thermo Fisher Scientific).

cDNA, siRNA, and shRNA constructs

The cDNAs of CDKL3 (HG11563-G; Sino Biological Inc.) was cloned into either pcDNA3.1 vector (V800-20; Invitrogen) or pLenti-Hygro vector (#17484; Addgene). sgRNA-resistant CDKL3 was first cloned into pGEM-T vector using the primer 5′-TGGAAAACCTGTGGATATCTGGGCTTTAGGATGCATGATTATCGAAATGGCCACTGGAAATCCCTATCTTCC and amplified using primers 5′-CTGGTTCTGGTTCTGAATTCATGATGGAGATGTATGAAACCCTTGGAAAAGTGG; 5′-CTCTAGACTCGAGCGGCCGCTCACCTCACACTGGGGTGAAAGAGATTTGA. The insert with triple-HA tag at their N termini (with GSGSGSEF as linker) was further cloned to pcDNA3.1 vector via Gibson Assembly (2621; New England Biolabs) and sequenced using primers 5′-GGGCTGATAAAGAAGGCAGAAAATT; 5′-TGCCTTGGCCTCCCAAAGTGCA. Indicated siRNAs (sequences listed in Table S1) were synthesized at Sangon Biotech. siRNAs were transfected reversely in a 96-well plate by using Lipofectamine RNAiMAX Transfection Reagent (#13778030; Thermo Fisher Scientific) according to the manufacturer’s protocol. Briefly, RNAiMAX Transfection Reagent and siRNA in Opti-MEM Medium (31985-070; Thermo Fisher Scientific) were incubated for 5 min at RT, followed by adding into cells seeded (5,000 cells/well) in a 96-well plate. The final siRNA concentration applied in the assay was 10 nM. After 12-h incubation, the cells were refreshed by normal culture medium. shRNA (ccgggaGGAGATATCTCAGAACCAActcgagTTGGTTCTGAGATATCTCCtctttttg) cloned in GV112 plasmid (AgeI; EcoRI; GENCHEM) was delivered into cells by using the lentiviral transfection system. Briefly, the transfection mixture prepared in Lipofectamine TM 2000 (Invitrogen) including 20 μg CDKL3-shRNA plasmid or control plasmid together with 15-μg pHelper 1.0 and 10-μg pHelper 2.0 was added to 293T cells in a 10-cm dish after 15-min incubation at RT. The viral particle supernatant was collected at 48 and 72 h after transfection and filtered through 0.45-μM syringe filters for further experiments. Infected cells were selected with puromycin (2 μg/ml) after 48-h incubation and maintained in puromycin-containing culture medium.

Bioinformatics analysis

Expression data matrix was obtained from public dataset (GEO accession number GSE21257; 53 OS samples; [Buddingh et al, 2011]) using the GEO query package in R. Differential expression between CDKL3 high expression group (top 30%; 17 samples) and CDKL3 low expression group (bottom 30%; 16 samples) was determined using differential expression analysis for sequence count data (DESeq v1.24.0; [Anders & Huber, 2010]). To obtain more differentially expressed genes rather than several significantly altered genes, a P-value cutoff of 0.05 was applied. KEGG gene annotation enrichment analysis using the clusterProfiler R package (Yu et al, 2012) was performed on differential expressed genes with a strict cutoff of P < 0.01 and a false discovery rate of less than 0.05. R package enrichplot (https://github.com/GuangchuangYu/enrichplot) achieves several visualization methods to help integrating enrichment results.

Reverse transcription and quantitative real-time PCR

Total RNAs from cells were purified by either Trizol or the Allprep DNA/RNA mini kit (QIAGEN). cDNA was generated by using iScript (Bio-Rad) according to the manufacturer’s protocol. Quantitative RT–PCR (qRT-PCR, for RNA) and PCR (for genomic DNA) were performed using FastStart SYBR Green Master (Roche). All primers are designed based on the primer bank of Massachusetts General Hospital (https://pga.mgh.harvard.edu/cgi-bin/primerbank). The reaction mixtures were incubated at 50°C for 15 min, followed by 95°C for 5 min, and then 35 PCR cycles were performed with the following temperature profiles: 95°C for 15 s, 60°C for 30 s, and 72°C for 1 min. The gene expression values were normalized to those of GAPDH. PCR primers are listed below:

• CDKL1-F: ACACGGGTCAGATTGTGGC;

• CDKL1-R: GGATTTCCCGAAGGGCAATTT;

• CDKL2-F: TCTCCCAGTCTGGCGTTGT;

• CDKL2-R: ACCATCGGGTTGCCACATAAT;

• CDKL3-F (for siRNA): TTCATCACGAAAACCTGGTCAA;

• CDKL3-R (for siRNA): AAGTCGCTTACTCTCTAGTCCAT;

• CDKL3-F (for shRNA): TCAAAGGAGGAAGAGGAGA;

• CDKL3-R (for shRNA): AGTTAGATTGATGGGTGGC;

• CDKL4-F: AGGGTCTTATGGGGTTGTATTCA;

• CDKL4-R: AGCTACTACTTGTCCAGAGGTTT;

• CDKL5-F: AGGAGCCTATGGAGTTGTACTT;

• CDKL5-R: TTTCCTGCTTGAGAGTCCGAA;

• CDK6-F: GCTGACCAGCAGTACGAATG;

• CDK6-R: GCACACATCAAACAACCTGACC;

• GAPDH-F: TGACTTCAACAGCGACACCCA;

• GAPDH-R: CACCCTGTTGCTGTAGCCAAA;

• ACTB-F: CATGTACGTTGCTATCCAGGC;

• ACTB-R: CTCCTTAATGTCACGCACGAT;

• AKT1-F: GTCATCGAACGCACCTTCCAT;

• AKT1-R: AGCTTCAGGTACTCAAACTCGT;

• AKT2-F: GGTGCAGAGATTGTCTCGGC;

• AKT2-R: GCCCGGCCATAGTCATTGTC;

• AKT3-F: TGAAGTGGCACACACTCTAACT;

• AKT3-R: CCGCTCTCTCGACAAATGGA;

• CCNG2-F: TCTGTATTAGCCTTGTGCCTTCT;

• CCNG2-R: CCTTGAAACGATCCAAACCAAC;

• CDKN1B-F: AACGTGCGAGTGTCTAACGG;

• CDKN1B-R: CCCTCTAGGGGTTTGTGATTCT;

• GADD45A-F: CCCTGATCCAGGCGTTTTG;

• GADD45A-R: GATCCATGTAGCGACTTTCCC;

• FASLG-F: CTCCGAGAGTCTACCAGCCA;

• FASLG-R: TGGACTTGCCTGTTAAATGGG;

• PDX1-F: GGAGCAGGATTGTGCCGTAA;

• PDX1-R: CTGTGGGGACGCACTAAGG;

• CAV1-F: CATCCCGATGGCACTCATCTG;

• CAV1-R: TGCACTGAATCTCAATCAGGAAG;

• FASN-F: CCGAGACACTCGTGGGCTA;

• FASN-R: CTTCAGCAGGACATTGATGCC;

• ACLY-F: ATCGGTTCAAGTATGCTCGGG;

• ACLY-R: GACCAAGTTTTCCACGACGTT;

• ACACA-F: TCACACCTGAAGACCTTAAAGCC;

• ACACA-R: AGCCCACACTGCTTGTACTG;

• PDPK1-F: CCTAAGGCAAGAGACCTCGTG;

• PDPK1-R: CGTCGTCTTCCGACATAGCC;

• HK1-F: CACATGGAGTCCGAGGTTTATG;

• HK1-R: CGTGAATCCCACAGGTAACTTC;

• SQSTM1-F: GACTACGACTTGTGTAGCGTC;

• SQSTM1-R: AGTGTCCGTGTTTCACCTTCC;

• CTSD-F: ATTCAGGGCGAGTACATGATCC;

• CTSD-R: CGACACCTTGAGCGTGTAG;

• ATP6V0D2-F: TCTGATCGAAACGCCATTAGC;

• ATP6V0D2-R: CTTCTTTGCTCAATTCAGTGCC.

Mixed and single clone KO cells

The selected sgRNA sequence (GGGCTGTATGATCATTGAGA) was cloned into lentiGuide-Puro vectors (#52963; Addgene). U2OS and Saos-2 cells that stably express Cas9 were generated using the Lenti-Cas9-Blast construct (#52962; Addgene) and were selected using blasticidin S (10 μg/ml, B12150.01; RPI). These Cas9-expressing cells were transduced with lentivirus that expresses sgRNA. The mixed stable cell lines were selected using puromycin. Single clones of U2OS or Saos-2 KO cells were generated by diluting the mixed KO cells at about 0.8 cell per well in 48-well plates. The genotype of single-cell clones was determined by amplifying the DNA fragments containing the sgRNA targeting region using the following primers: CDKL3 forward: CTGATCTGTTTCAGACCTGTG; CDKL3 reverse: 5′-GCATCAACCATCAACATATGG, followed by ligating the PCR product into T-vectors (A3600; Promega). The ligation products were transformed into Escherichia coli (DH5α strain) and plated onto agar plates. Single-clone colonies were selected, and their plasmids were extracted and sequenced.

Serum starvation assay

Cells were plated in six-well plates for 80% confluency before use. When the assay began, all medium was removed, and the cells were washed by cold PBS twice. Either DMEM+10%FBS or DMEM alone were added to the cells for 24 h. The cultured medium was removed after reaching designed time courses. The cells were washed by cold PBS twice and subjected to lysis.

Cell growth assay

U2OS-GFP and Saos-2-GFP stable cell lines were established by transduction of ZsGreen (a gift from Bryan Welm and Zena Werb, plasmid #18121; Addgene) expression lentivirus (Welm et al, 2008), monoclonal cell population was isolated by limiting dilution in 48-well plates. U2OS-GFP expression cells were seeded at 3,000 cells/well in 96-well black-walled plates (Cat. no. 3603; Corning), cell growth was measured daily using FLUOstar Omega Filter–based multimode microplate reader (BMG Labtech) with the excitation wavelength at 485 nm and emission at 510 nm. Growth fold at day N was determined by Day N absorbance divided by Day 1.

Methyl thiazolyl tetrazolium (MTT) assay for cell proliferation

Cells transducted with lentivirus expressing indicated shRNAs were plated on 96-well plates at a density of 3,000 cells per well in triplicates and incubated for 1–5 d. MTT (thiazolyl blue tetrazolium, from Sigma-Aldrich) was added into each well for a final concentration of 0.5 mg/ml, and the plates were incubated in 37°C for additional 4 h. After the incubation, all the medium was removed and 100 μl of DMSO was added to each well. Then, the test-ready plate was assayed by Synergy H1 microplate reader at OD₄₉₀. Growth curve was drawn by according to relative cell growth fold, which was determined by Day N absorbance divided by Day 1.

Colony formation assay

Saos-2 and U2OS cells seeded in six-well plates at 800 and 5,000 cells per well in six-well plates on the third day after infection were cultured for 14 d to form colonies. The cells were subsequently treated by washing with PBS, fixing in 4% paraformaldehyde for 15 min, staining with 0.5% crystal violet for 1 h, washing three times by ddH₂O and photographing with a digital camera. The number of colonies was counted. All assays were performed in triplicate.

Cell culture wound healing assay

U2OS, Saos-2 cells and their CDKL3-KO (U19 and S4) cells at a density of ∼2 × 10⁵ were plated in a 12-well plate for 90–100% confluence in 24 h. A straight wound was created inside a biosafety hood by manually scraping the cell monolayer with a 1000-μl pipette tip followed by aspirating the medium and cell debris with PBS, and the full culture medium was then carefully added against the well wall without detaching cells. Following photographing the initial wounds, the plate was placed back to an incubator at 37°C with 5% CO₂. At several time points after scraping (e.g., 0, 4, 6, 20, 24, and 48 h), the snapshot pictures of the wound closure were taken, and the healing area was measured under the microscope (Leica). At least six different wound areas were photographed for each cell types.

Cell invasion and migration assay

The cell invasion and migration assay was conducted according to the manufacturer’s introduction (CBA-100-C; Cell Biolabs) (Airoldi et al, 2016; Li et al, 2017). Briefly, 300 μl of warm serum-free medium was added to the cell culture inserts to rehydrate the basement membrane for 1 h at RT, 500 μl of complete cell culture medium supplemented with 10% FBS was added to the lower well of the invasion or migration plate. 300 μl of cell suspension in the serum-free medium (1.5 × 10⁵ cells) was seeded to the inside of each insert and incubated for 24 h in a cell culture incubator at 37°C. The medium inside the insert was carefully aspirated and any noninvasive cells were removed using 2–3 cotton swabs. The insert was then stained with 400 μl of cell stain solution, incubated for 10 min at RT, and washed three times with water. The dried insert membrane was ready for imaging under a microscope. To quantitively analyze the degree of invasion and migration of indicated cells, 200 μl of extraction solution was added to each membrane in an empty well, followed by incubating for 10 min on an orbital shaker. 100 μl of the extraction solution was transferred to a 96-well microtiter plate and the OD at 550 nm was measured in a plate reader. CellEvent Senescence Green Detection Kit from Invitrogen (C10850) was used to detect senescence-associated β-galactosidase (SA-β-gal) activity following the manufacturer’s instructions (Murcia et al, 2019).

Growth of cells in athymic nude mouse and tumor size determination

U2OS cells transfected with Lv-sh Control or Lv-sh CDKL3 were trypsinized, washed, and resuspended in PBS. Designed cell number and viability were determined using trypan blue. Sixteen 6–8-wk-old male athymic nude mice (BALB/cASlac-nu, from Shanghai SLAC laboratory animal CO. LTD) were randomly divided into two groups (8 mice/group) followed by s.c. injecting with U2OS cells at a density of 1 × 10⁶ cells per site. The tumor size was determined every 3–4 d after the tumor was formed as previously described (Xiang et al, 2017). Tumor volumes were measured, and the mice were weighed twice weekly. Tumor photographing and weighting were conducted on day 16 immediately after euthanizing tumor-bearing mice. Tumor volume was calculated using the formula: ½ (Length × Width²). All animal experiments were approved by the Animal Care and Use Committee of Shanghai Sixth People’s Hospital (Approval No.: 2016-0107).

Growth competition assay

Wild-type GFP-expressing U2OS and Saos-2 cells were cocultured with CDKL3-KO U2OS and Saos-2 cells at different ratios, and the cells were passaged when reaching 80–90% confluence (as indicated at days post coculture in Fig S6), the percentage of GFP-positive cells was measured by FACS.

Autophagy induction

CDKL3-KO and wild-type U2OS and Saos-2 cells were cultured in eight-well chamber slides (#154534; Thermo Fisher Scientific) to 70–80% confluence, and the cells were then co-transfected with a tandem fluorescent-tagged RFP-GFP-LC3 reporter plasmid (ptfLC3, #21074; Addgene) and sgRNA-resistant CDKL3 or control plasmid using PolyJet (#SL100688; SignaGen Laboratories) according to the manufacturer’s protocol. The medium was changed into culture medium 24 h post-transfection, and the cells were subjected to 6-h starvation with EBSS medium (E2888; Sigma-Aldrich) on the next day. The cells were then fixed in 4% paraformaldehyde and imaged using the Olympus DSU-IX81 Spinning Disk Confocal System. Images were pseudocolored and analyzed using ImageJ. Yellow dots (eGFP⁺ mRFP⁺) were considered as autophagosomes, whereas RFP only (red dots) as autolysosomes.

Small molecule growth inhibition assay and IC50 assay

For the small molecule inhibitors, rapamycin, AZD5363, and MK-2206 were all purchased from Selleckchem and dissolved in DMSO. In the growth assay, the cells were plated into 24-well plates at 1,000 cells to start with for each well. After plating for 4 h, “day 0” wells were trypsinized and counted by a cell counter manually. Each condition was plated into three wells and counted three times. After that, the cells were counted by the same approach every 48 h till “day 8.” The concentrations of rapamycin, AZD5363, and MK-2206 used in the assay are 2 nM, 80, and 15 μM, respectively. Equal amount of DMSO was added for the control groups. For the IC₅₀ assay, 2,000–3,000 cells were plated into each well of 96-well plate. Different concentrations of small molecules were added into each well by the same volume, as DMSO was added to the control group. After 72 h, the MTT assay will be tested as indicated above.

In vitro kinase assay

The GST-Akt was cloned into pGEX4T-1 vector for E. coli expression. The E. coli strand BL21 was used for plasmid transformation. After transformation, a single colony was inoculated into LB medium for growth with ampicillin at 37°C. At OD₆₀₀ = 0.6, 0.2 mM IPTG was added to the bacterial culture for overnight induction at 18°. Next day, the cell pellets were harvested by centrifugation and lysed in buffer (50 mM Tris–HCl, 200 mM NaCl, and 10% [vol/vol] glycerol, pH = 7.9) by sonication on ice. After sonication, the lysate was centrifuged, and the supernatant was subjected to GST-resin (GenScript) for incubation at 4°C for 2 h. The GST-resin was then applied to the gravity column. After reduced glutathione elution, the proteins went through the size exclusion column (Akta) for purification. HA-CDKL3 was transfected into HEK293T cell lines in a 10-cm dish. After transfection by Lipofectamine 2000 (Invitrogen) for 24 h, the petri dish was refreshed by clean medium. After 48 h, the cells were harvested and lysed. The HA-conjugated agarose was added to the whole cell lysate to enrich HA-CDKL3. After enrichment, HA epitope peptide (YPYDVPDYA, synthesized by Biotherm, purity >95%) was used to elute HA-CDKL3 from resin. All proteins were checked by Western blot before in vitro kinase assay. For the in vitro kinase assay, proper amount of GST-resin (GST alone or GST-Akt) with HA-CDKL3 or BSA was mixed together in 1× Kinase Buffer (Hepes 20 mM, MgCl₂ 50 mM, sodium orthovanadate 1 mM, EDTA 1 mM, and DTT 1 mM, pH = 7.5). At the condition of adding ATP (from Santa Cruz Biotech, final concentration in reaction: 0.2 mM) or distilled water, the reactions were performed at 30° for 30 min. Then, the reactions were stopped immediately by adding 3× SDS-containing Laemmli buffer at due time.

Western blot and Co-IP

The antibodies were purchased from the following companies: Cell Signaling Technology: LC3, Pan-Akt (Rb and Mo), Akt pT308, Akt pT450, GAPDH, p70S6K, p70-S6K pT389, mTOR, GSK3β, GSK3β pS9, 4E-BP1, p4E-BP1, Atg12, Beclin-1, HA, myc, GST, and IgG; Invitrogen: CDKL3 (NKIAMRE) and Akt pS473; ImmunoWay: mTOR pS2448 and mTOR pS2481; ProteinTech: FoxO1 and FoxO3a; and Santa Cruz Biotech: β-actin and protein G agarose. The HA antibody–conjugated and myc antibody–conjugated agarose was purchased from Pierce. For Western blot, the cell was lysed by Passive Lysis Buffer (25 mM Tris–HCl, 150 mM NaCl, and 1% NP40) containing protease inhibitor cocktail (Roche). Total protein amount was determined by the BCA assay (Pierce), and appropriate amount of denatured protein with Laemmli loading dye was loaded onto 6% or 10% poly-acrylamide gel for SDS–PAGE. After that, the PVDF membrane was used for transfer, and TBS-T buffer containing 5% BSA with 0.02% sodium azide was used in membrane blocking and antibody incubations. The chemiluminescent substrate kit was purchased from Tanon. Final quantification of gel intensity was performed by ImageJ and plotted in Prism 8.0. For co-IP, the total lysate of cell was subjected to α-HA-agarose, α-myc-agarose, or incubated with α-Akt/IgG and protein G agarose at 4°C overnight. Next day, the resin was washed thoroughly by TBS-T for five times with 10-min incubation and shaking intervals at 4°C before subjected to SDS–PAGE and Western blot.

Tissue microarray

A total of 152 formalin-fixed, paraffin-embedded OS tissue samples were randomly selected for tissue microarray construction. Areas-of-interest tumor regions were identified and marked on the source block. Representative 1-mm diameter tissue core from each case were punched from the original block and inserted into a new recipient paraffin block using a tissue arraying instrument (Beecher Instruments), and 4-μm sections were cut using a microtome and mounted on a glass slide.

IHC analysis

Paraffin sections (4-μm thickness) were deparaffinized and treated with 3% hydrogen peroxide for 10 min to quench the endogenous peroxidase activity. Antigenic retrieval was performed by submerging in citric acid (pH 6.0) and microwaving. The slides were then allowed to cool at RT, followed by incubation in normal goat serum for 1 h to block nonspecific binding, then incubated overnight at 4°C using the following primary antibodies: CDKL3 (NKIAMRE, PA5-72930; Invitrogen), Ki67 (clone SP6, ab16667; Abcam), AKT Pan Monoclonal antibody (clone J.314.4, MA5-14916; Invitrogen), phospho-AKT1 (Thr308, clone B18HCLC, 710122; Invitrogen), Phospho-Akt (Ser473, clone D9E, 4060; Cell Signaling Technology), and LC3B (2775; Cell Signaling Technology). The staining was examined using HRP EnVision Systems (Dako). Rabbit IgG was used as a primary antibody for negative control. Each section was evaluated by three independent pathologists without the knowledge of the clinical case features. The results of IHC staining were evaluated independently by two trained pathologists without the knowledge of clinical data. The specimens stained for CDKL3 and NKIAMRE were graded into three groups according to the strength of the staining color: − represents no staining and +, ++, and +++ represent weak, intermediate, and strong staining, respectively. For Ki-67 staining, a labeling index was assessed by counting the percentage of positively stained cells in different regions containing 500 cells in each core.

Molecular docking procedure

Docking experiments were performed using ClusPro 2.0 program (Comeau et al, 2004a, 2004b). The 3D crystal structure of human CDKL3 (PDB ID: 3ZDU) and Akt1 (PDB ID: 6BUU) were obtained from the Protein Data Bank. The Akt1 monomer was docked into the CDKL3 to generate predicted binding models of CDKL3:Akt1. Models with the highest scores and good topologies were selected for the proposed models of the interaction between CDKL3 and Akt1. Images were generated using PyMoL.

Cases

152 OS patients admitted to Shanghai Sixth People’s Hospital from 2006 to 2014 were enrolled in this study. Pathological results were based on specimens obtained at diagnosis. All the patients received surgery and adjuvant chemotherapy; the surgical margins were classified according to the Enneking staging system. Patients were followed at a 3-mo interval and their clinical data were updated for at least 5 yr. The patients’ clinical characteristics including age, gender, pathologic subtypes, tumor site, Enneking surgical stage, Karnofsky Performance status score, recurrence, and metastases were collected for statistical analysis. Progression-free survival and overall survival were calculated from the date of initial diagnosis. Consent for collection of patient specimens and using patient characteristics for this study and publication was approved by the Independent Ethics Committee of the Shanghai Sixth People’s Hospital (Approval No.: 2018-079). All patients signed informed consent forms.

Statistical analysis

All statistical analyses were performed using the SPSS statistical software (version 19.0; IBM Corp.) or Prism8 (GraphPad). Overall survival was defined as the time from the date of diagnosis to the date of the last follow-up or death from any cause. Chi-square test or Fisher’s exact test was used to compare clinical differences between patients with negative or positive of CDKL3. Kaplan–Meier analysis was performed to generate survival curves. An unpaired two-tailed t test was used for comparisons between two experimental groups. P-values were two-sided, and a P < 0.05 was considered statistically significant.