Oxidised metabolites of the omega-6 fatty acid linoleic acid activate dFOXO

Drosophila strains

The hop^Tum strain is as described by Hanratty and Dearolf (1993). An isogenic w¹¹¹⁸ strain (Badenhorst et al, 2002) was used as a control. Pxt^f05258 and Pxt^EY03052 were obtained from the Bloomington Drosophila Stock Center. dFOXO⁹⁴ (Slack et al, 2011) and dFOXO-mCherry, an mCherry knock-in the endogenous dFOXO locus (Kakanj et al, 2016) were provided by Linda Partridge. bsk¹ and puc^E69, UAS-bsk-DN, and UAS-bsk-RNAi^GD10555 were provided by Yun Fan. FB-GAL4 (Gronke et al, 2003) was provided by Ines Anderl.

Cell lines

HeLa cells (CCL2 isolate, RRID: CVCL_0030) were obtained from the ATTC and STR profile verified (Amelogenin: X, CSF1PO: 9,10; D13S317: 12,13.3; D16S539: 9,10; D5S818: 11,12; D7S820: 8,12; THO1: 7; TPOX: 8,12; vWA: 16,18). HeLa Cells were incubated at 37°C with 5% CO₂ and cultured in DMEM containing 10% FBS, 100 U penicillin–streptomycin (Sigma-Aldrich), 1 mM glutamine (GIBCO), and 1× nonessential amino acids (Sigma-Aldrich). Drosophila Schneider 2 (S2) cells were obtained from Invitrogen (RRID: CVCL_Z232). Cell stocks have been tested for contamination of bacteria, yeast, mycoplasma, and virus and characterized by isozyme and karyotype analysis. S2 cells were cultured at 25°C in protein-free medium containing L-glutamine (Insect-express; Lonza), supplemented with 10% FBS, 100 U penicillin–streptomycin (Sigma-Aldrich).

Drosophila inflammatory tumour assay

Drosophila were raised on dextrose, wheat flour, yeast, and agar media. For melanotic tumour assays, five hop^Tum/FM7 females (Luo et al, 1995) were crossed with either five w¹¹¹⁸ males as a control or five mutant males (in the case of mutant enhancer/suppressor studies) per vial. Crosses were allowed to mate for 2 d before being transferred to fresh media. Five initial vials were set up for each datum point and were incubated for 3 d before being transferred to a second fresh set of vials, giving a total of 10 replicates per experiment. The total number of animals assayed for each data-point was in the range 250–300. Required sample size was estimated using a statistical power calculator (https://www.stat.ubc.ca/∼rollin/stats/ssize/n2.html) assuming an error rate of 0.01 and required power 1.00. Crosses were incubated for 3 d and the adult flies then removed. hop^Tum females of the next generation were scored for tumour incidence using a Nikon SMZ645 stereomicroscope. All crosses were maintained on standard media or supplemented media where stated, and all crosses were incubated at 27°C unless otherwise stated.

Drosophila larval fatty acid supplementation

The following oils where added to the standard Drosophila medium before pouring into vials. As omega-6 PUFA source: safflower oil (Clear spring) containing 79% LA, 11% oleic acid (C18:1cis [n-9]), and 7% palmitic acid (C16 SFA). As omega-3 PUFA source: flaxseed oil (Food Supplement Company) containing 55% of α-linolenic acid, 18% oleic acid and 17% LA. As SFA source: coconut oil (Sigma-Aldrich) containing 92% SFA (including 48% lauric [C12], 20% myristic [C14], and 9% palmitic [C16] acids), with 6% monounsaturated FA and 1.7% PUFA (LA). Tumour assays using hop^Tum/w¹¹¹⁸ female progeny were conducted as described above at 25°C (to detect enhancers) and 27°C (to detect suppressors). As the hop^Tum mutant is temperature-sensitive-conditional, by varying culture temperature, the strength of JAK activation and baseline tumour incidence can be modified allowing both enhancers and suppressors to be assayed. Crosses were raised in the constant presence of the respective FAs under investigation. 9-(S)-HODE was supplemented to 1 μM final concentration in media to assay effects on melanotic tumour formation.

MPO inhibitor treatment

The inhibitor myeloperoxidase inhibitor 1 (Calbiochem) was added to Drosophila culture medium supplemented with 0.15% safflower oil at concentrations spanning the published IC₅₀ (Kettle et al, 1995). Inhibitor was dissolved in DMSO (Sigma-Aldrich) and then added to fly media before pouring. Melanotic tumour assays using hop^Tum/w¹¹¹⁸ female progeny were conducted at 27°C as described above. Media supplemented with vehicle alone provided reference control.

Microarray analysis

For 9-HODE treatment, confluent S2 cells were split 1:4 to each well of a six well plate followed by addition of either 10 μΜ 9-(S)-HODE (Cayman Chemical) or equivalent volume of ethanol (vehicle only control). The cells were cultured for either 12 or 24 h and mRNA extracted using a μMACS mRNA Isolation kit (Miltenyi Biotec). The samples were assessed using an Agilent Bioanalyser 2100 with Nano RNA chip, and mRNA was dye-labeled (Cy3 for Control and Cy5 for HODE-treated) using the Agilent Low Input Quick Amp labeling method. Unbound fluorophore was removed using QIAGEN RNeasy columns and pairs of labeled samples mixed and fragmented in the presence of Agilent blocking reagents at 60°C for 30 min. The samples were hybridised to Agilent Drosophila Gene Expression Microarray, 4x44K arrays at 65°C for 17 h at a speed of 10 rpm. Slides were washed using the Agilent supplementary wash procedure and slides scanned using an Agilent Scanner C at 5-μm resolution using Agilent Scan Control Software 8.5 and the AgilentHD_GX_2 Color profile. The image was then imported into Agilent’s Feature Extraction 10.10 software and the feature extraction was performed.

Statistical analysis was performed using R version 3.1.2 (http://www.R-project.org) and the marray and limma libraries of Bioconductor version 3.4 (http://www.bioconductor.org). Differential expression of genes was determined using an empirical Bayes approach within limma (Ritchie et al, 2015), with factors Control, HODE-12, and HODE-24. Moderated t statistics based on shrinkage of the estimated sample variance toward a pooled estimate and the corresponding P values were calculated for the HODE-12 versus Control and HODE-24 versus Control comparisons. P values were adjusted according to Benjamini & Hochberg (1995) to control the false discovery rate, and a threshold of 0.05 was used to select probe sets. Probe sets with statistically significant changes relative to wild-type were determined using the topTable function in limma. Genes with altered expression at respectively HODE 12-h treatment and HODE 24-h treatment are listed in Supplemental Datas 1 and 2. Array datasets are available through ArrayExpress (accession number E-MTAB-6253). GO network analysis was performed using the ClueGO Cytoscape plugin (Bindea et al, 2009). Size of nodes reflects significance of enrichment. Gene network analysis was performed using the esyN network tool (Bean et al, 2014) and nodes coloured according to array expression data using Cytoscape (Shannon et al, 2003). Regulatory networks of HODE up- and down-regulated genes were identified using the iRegulon app (Janky et al, 2014) in Cytoscape (Shannon et al, 2003) and nodes displayed in degree sorted circle format.

Cell cycle analysis

S2 cells were grown in six-well plates as described above and treated with vehicle alone or increasing concentrations of 9-(S)-HODE for 24 h. Cells were pelleted, resuspended in 1 ml 1× PBS, and fixed using 4% formaldehyde (Sigma-Aldrich) for 10 min. Cells were washed twice using 1× PBS, resuspended in 1 ml PI/RNase staining buffer (BD Pharmingen), and incubated at room temperature for 30 min before analysis on a Beckman Coulter Cyan ADP analyser. The S2 population was gated using forward scatter and side scatter and PI staining quantitated using 800 V setting. PI staining distribution was determined using Summit V4.3.02 analysis software.

Lipid extraction

200 mg of larvae samples was thawed and transferred to a Dounce glass homogeniser. Samples were homogenised in 500 μl ice-cold methanol using a glass pestle and mortar. The homogenate was transferred to a glass vial. The mortar was washed twice with 100 μl methanol and added to the homogenate. Ice-cold water was added to make a final 15% vol/vol methanol:water homogenate. 20 μl of 1 ng/μl internal standard PGB₂-d₄ (Cayman Chemicals) was added. The homogenate was left for 15 min on ice in the dark and then centrifuged at 4°C for 10 min at 130g to remove precipitated proteins. The supernatant was transferred to a glass vial and acidified to pH 3.0 using 0.1 M HCL. Acidified extracts were applied to the pre-conditioned solid phase extraction cartridges (C18-E; Phenomenex) where lipid mediators were eluted with methyl formate. Extracts were dried under nitrogen, in the dark, and reconstituted in 100 μl 70/30:vol/vol ethanol/water.

LC/ESI-MS/MS analysis

Lipid mediator analysis was carried out as described previously (Massey & Nicolaou, 2013). LC-MS/MS analyses were performed on a Waters Alliance 2695 HPLC pump coupled to an ESI triple quadrupole Quattro Ultima mass spectrometer (Waters). Chromatographic separation of the lipid mediators was carried out using a C18 Luna column (5 μm, 150 × 2.0 mm; Phenomenex). Chiral analysis of 9- and 13-HODE was carried out using a LUX cellulose-1 column (3 μm, 150 × 2.0 mm; Phenomenex). The metabolites were measured using multiple reaction monitoring using the following transitions: PGE₂: m/z 351>271, m/z 351>315, m/z 351>333; PGF_2α: m/z 353>193, m/z 353>247, m/z 353>309; 9-HODE: m/z 295>171; 13-HODE: m/z 295>195. Quantitation was based on calibration lines constructed with commercially available standards (Cayman Chemicals).

Protein over-expression vectors

The doxycycline-inducible vector pTRE3G (Clontech) was modified to incorporate an optimised 3XFLAG tag (MDYKDHDGDYKDHDIDYKDDDDK) to generate the vector pTRE3G-FLAG. cDNA encoding the haem peroxidase domain of Pxt (aa38-798) was cloned into pTRE3G-FLAG allowing over-expression of N-terminally 3XFLAG-tagged proteins. Sequences were inspected using SignalP 4.1 to exclude signal peptide and pro-protein cleavage sites.

Stable cell lines

HeLa cells were split to 50% confluency and transfected with 3 μg pCMV-Tet3G activator vector and 500 ng of each pTRE3G-FLAG expression vector using Lipofectamine LTX (Invitrogen) in serum-free medium. Transfected cells were incubated at 37°C with 5% CO₂ overnight. Stable transfectants were selected with 300 μg/ml neomycin (Sigma-Aldrich).

Protein over-expression and purification

Stable cell lines and non-transfected HeLa cells (control) were grown to 50% confluency in T150 flasks (Corning) and FLAG-tagged protein expression induced with 5 μg/ml of doxycycline (Sigma-Aldrich) for 48 h. After 24 h, the medium was discarded and fresh medium with doxycycline was added. The cells were trypsinized using 1× trypsin–EDTA (Sigma-Aldrich) for 5 min and pelleted by centrifugation at 300g for 5 min at 4°C. Pellets were washed with 1× PBS and lysed in 1× RIPA buffer (Sigma-Aldrich) containing protease inhibitors (Complete; Roche) on ice for 30 min. Lysates were cleared by centrifugation at 4900g for 10 min at 4°C. FLAG-tagged proteins were purified by incubation with Anti-FLAG M2 monoclonal antibody (Sigma-Aldrich)–coated Protein G Dynabeads (Life Technologies). The beads were washed three times with 1× RIPA buffer (Sigma-Aldrich) and proteins eluted by two incubations with 20 μl elution buffer (100 μg/ml 3× FLAG peptide [Sigma-Aldrich], 100 mM Tris–HCl [pH 8.0], and 100 mM NaCl, 20% glycerol). Eluted protein was stored at −80°C until use.

MPO assay

Protein levels of purified fusion proteins were normalised by Bradford assay (Bio-Rad) and confirmed by Western blotting. FLAG-tagged proteins were separated on 8% SDS–PAGE gels, transferred to polyvinylidene fluoride (PVDF) membrane (Millipore), and detected using mouse anti-FLAG M2 monoclonal antibody (Sigma-Aldrich) at 1:1,000, anti-mouse HRP-conjugated IgG (H+L) secondary antibody (Amersham) at 1:10,000, and SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific). To assay MPO activity, the COX Fluorescent Activity Assay Kit (Cayman Chemical) protocol was modified by substituting AA in the assay with 10 μl 5 mM hydrogen peroxide. Assays were monitored using a Fluoroskan (Ascent 1.6; Labsystems) with an excitation wavelength of 550 nm and an emission wavelength of 615 nm. Ascent research addition 1.2.3.1 program was used to analyse the data. Duplicate reactions containing MPO inhibitor 1 (Calbiochem) were also assayed. The COX standard internal control provided by the assay kit was used as a positive control.

ChIP

ChIP was performed on mock and 9-(S)-HODE treated S2 cells (10 μM for 24 h) as described in Kwon et al (2016). Briefly, 10 million cells were fixed by addition of 1% formaldehyde for 15 min at 25°C, pelleted, and washed 3× in ice-cold 1× PBS before storage at −80°C. The cell pellets were resuspended in 150 μl ChIP Lysis Buffer (1% SDS, 10 mM EDTA) and sonicated for 20 min using a Diagenode Bioruptor sonicator (cycles of 30 s on/off, hi power). Samples were diluted 10-fold in ChIP dilution buffer. The samples were pre-cleared using Protein G–conjugated Dynabeads (Invitrogen) for 30 min at room temperature, followed by incubation with antibody-coated Protein G–conjugated Dynabeads (Invitrogen) for 3 h at 4°C. Immune complexes were recovered by magnetic selection and washed once with low-salt buffer (20 mM Tris [pH 8.1], 150 mM NaCl, 2 mM EDTA, 0.1% SDS, and 1% Triton X-100), once with high-salt buffer (20 mM Tris [pH 8.1], 500 mM NaCl, 2 mM EDTA, 0.1% SDS, and 1% Triton X-100), once with LiCl immune complex wash buffer (10 mM Tris [pH 8.1], 1 mM EDTA, 0.25 M LiCl, 1% IGEPAL CA-630, and 1% deoxycholic acid), and twice with TE buffer for 5 min each at room temperature. ChIP DNA was eluted using two washes of elution buffer (1% SDS and 0.1 M NaHCO₃) for 15 min at room temperature. Cross-links were reversed as described above and ChIP DNA purified using 1.8 volumes Agencourt AMPure XP beads (Beckman Coulter). Rabbit anti-dFOXO antibodies (Donovan & Marr, 2016) were used for immunoprecipitation.

Enrichment at known dFOXO targets was assayed by real-time PCR relative to control genomic loci using primers listed in the key resources table. Real-time PCR was performed on an Applied Biosystems Step One Plus real-time PCR machine. Reactions were performed using Absolute QPCR SYBR green ROX mix (AB-1162; Thermo Fisher Scientific). Primers used were: foxo-control-f AGCCCGCGAAGATACAAGAG; foxo-control-r AGCCACAAACAGCGACAGAA; pdcd4-f CCGTTGGGAGTCTCTCTCTC; pdcd4-r GCTCTCCCCACCTTCTCACC; hsp26-f GTGCGCCTGTATGAGTGAGA; hsp26-r GTGGGAGATTGCTGGCGTTA; 4EBP-f CAAGAACCAGCCGGTTTGTC; 4EBP-r GCTCTCTTCTCGCTCTTTCG. ChIP values in the presence and absence of 9-HODE at known FOXO targets and control genomic regions were calculated as a % of input using the Delta-Ct method. Input cycles were adjusted (Ct-6.64) to take into account that 1% of chromatin used in the ChIP was reserved for input. These ChIP values were then used to generate fold enrichment after addition of 9-HODE.

Immunofluorescence microscopy

Immunofluorescence was performed on mock and 9-(S)-HODE–treated S2 cells (10 μM for 24 h). For experiments to investigate whether 9-(S)-HODE requires ROS to induce dFOXO nuclear localisation, S2 cells were simultaneously treated with 100 μg/ml N-acetyl-L-cysteine (NAC; Sigma-Aldrich). To test whether 9-(S)-HODE induces ROS, mock and 9-(S)-HODE–treated S2 cells (10 μM for 24 h) were stained using CellROX Green Reagent (Life Technologies) that allows oxidative stress to be detected in live cells. Insulin treatment (from bovine pancreas; Sigma-Aldrich) was performed on mock and 9-(S)-HODE–treated S2 cells (10 μM for 24 h) at 1 μg/ml for 90 min. FCS was added to cell suspension to a final concentration of 20% and the cells centrifuged onto glass slides using a Cytospin3 (Shandon) slide centrifuge for 5 min at 112g on low acceleration and deceleration setting. The cells were fixed with 4% paraformaldehyde for 10 min at room temperature and washed with 1× PBS for 10 min before blocking overnight at 4°C in blocking buffer (1× PBS, 0.1% Tween-20, 0.1% FCS). Primary antibody incubation was performed in blocking buffer for 2 h followed by three washes in PBTw buffer (1× PBS, 0.1% Tween-20). Secondary antibody incubation was performed in PBTw at room temperature for 1 h using either Cy3-conjugated AffiniPure goat anti-rabbit antibody (Cat. no. 111-167-003; Jackson ImmunoResearch) or FITC-conjugated AffiniPure Donkey anti-mouse antibody (Cat. no. 715-095-151; Jackson ImmunoResearch) at 1:400 dilution. The samples were washed as above and mounted using Vectashield with DAPI (Vecta Laboratories). Primary antibodies used were rabbit anti-dFOXO (Donovan & Marr, 2016) (1:1,000) and mouse anti-pJNK (phospho-SAPK/JNK (Thr183Tyr185) MAb G9, CST, 1:100).

Fat bodies and salivary glands were dissected from dFOXO-mCherry third instar larvae. Tissue was incubated in insect-express medium containing L-glutamine (Lonza) with 10% FCS and with or without addition of 10 μM 9-(S)-HODE. Incubations ranged from 3 h to overnight (18 h) incubations. The samples were fixed in 4% paraformaldehyde for 15 min at room temperature, followed by three washes in 1× PBS and mounted using Vectashield with DAPI (Vecta Laboratories). dFOXO nuclear localisation was imaged using a Zeiss LSM780 confocal microscope. Control (mock-treated) and experimental samples (9-(S)-HODE–treated, 13-(S)-HODE–treated, and 9-(S)-HODE–treated + RNAi) were fixed and imaged in parallel using identical imaging settings. Images were exported as TIFF files and nuclear signals quantitated using ImageJ. Data represent mean and SD of at least 10 image panels per experiment (5–7 nuclei per panel).

Western blotting

Mock and 9-(S)-HODE treatment of S2 cells was performed in six-well plates (three wells per condition) as described above. After treatment, the cells were resuspended and wells pooled then pelleted by centrifugation at 300g for 5 min at 4°C in a 15-ml falcon tube. The media was removed and cells washed in 5 ml 1× PBS. Cell pellets were resuspended in 1× RIPA buffer (Sigma-Aldrich) containing protease inhibitors (Complete; Roche) and cells lysed by sonication on ice (30% power, for 30 s, four repeats) using a Vibra cell VC130 sonicator (Sonics). The lysate was cleared by centrifugation for 10 min at 21,000g using a microcentrifuge. The supernatant was transferred to a new tube and protein concentration measured using 1× Bradford assay (Bio-Rad). 25 μg of extract from each induced protein line was ran on an 10% SDS–PAGE gel using an XCell SureLock Mini-Cell Electrophoresis System (Invitrogen) with Tris–glycine running buffer (25 mM Tris, 192 mM glycine, and 0.1% SDS) at 125 V for 2 h. Proteins were transferred to PVDF membrane (Bio-Rad) using an X Cell II Blot Module (Invitrogen) and Tris–glycine transfer buffer (12 mM Tris and 96 mM glycine) containing 20% methanol at 30 V for 2 h. Membrane was blocked overnight at 4°C in 1× Tris buffered saline with Tween-20 (TBST [50 mM Tris–Cl, pH 7.4, 150 mM NaCl, and 0.1% tween 20]) containing 5% dried skimmed milk powder. Primary antibody incubation was performed in blocking buffer at room temp for 1.5 h. Membranes were washed three times for 10 min each in TBST and secondary antibody incubation performed in TBST for 1 h at room temperature. Membranes were washed as above and the signal was detected following Supersignal West Pico Chemiluminescent Substrate (ECL substrate; Thermo Fisher Scientific) reaction for 5 min. The signal was visualised using Hyperfilm ECL (Amersham). Primary antibodies used were rabbit anti-dFOXO (Donovan & Marr, 2016) (1:1,000), mouse MAb E7 anti-tubulin (Developmental Studies Hybridoma Bank, 1:100), and mouse anti-pJNK (anti-phospho-SAPK/JNK (Thr183Tyr185) MAb G9, CST, 1:2,000). Secondary antibodies were anti-mouse and anti-rabbit HRP-conjugated IgG (H+L) secondary antibody (Amersham) at 1:10,000.

Survival and infection assays

Natural lifespan and survival after infection was assayed using Pxt^f05258 and w¹¹¹⁸ flies. For each fly strain, five replicates of 50 male flies, in total 250 flies, were used per assay. Adult virgin males were collected, aged for 1 d, and placed in vials containing standard Drosophila medium. Vials were incubated at 25°C and survival recorded daily. The medium was changed regularly during the assays. Kaplan–Meier survival curves were produced using the SPSS statistics package. Survival in response to sterile wounding was tested. Flies were anaesthetised on a CO₂ pad and wounded between the A5 and A4 dorsal abdominal tergites using a fine-sterilised platinum needle that had been dipped in sterile 1× PBS. Survival after exposure to B. bassiana (CABI), a pathogenic fungal strain, was also assayed. B. bassiana was cultured on potato and carrot agar plates for 3 d when it reached peak sporulation. Flies from each genetic strain were anesthetised using CO₂. For the control group, for each replicate, the flies were placed onto a sterile potato and carrot agar plate and shaken gently over the plate for 10 s and then placed into a fresh vial. For the infected group, flies were treated in the same way, but shaken over the B. bassiana grown potato and carrot agar plate.

Real-time PCR analysis of transcript levels

mRNA was isolated using a μMACS mRNA Isolation kit (Miltenyi Biotec). cDNA was generated by reverse transcription using Superscript II (Invitrogen) at 50°C. Real-time PCR was performed on an Applied Biosystems Step One Plus real-time PCR machine. Reactions were performed using Absolute QPCR SYBR green ROX mix (AB-1162; Thermo Fisher Scientific). Primers used are described below. RpL32 transcript provided the endogenous control for normalisation. RNA was isolated from five third instar larvae of the appropriate genotype and media treatment. Data are mean and SD of three biological replicates. Primers for PCR were as follows

• RpL32-F ATCCGCCACCAGTCGCATCGATATGCTAAG,

• RpL32-R TCTTGAGAACGCAGGCGACCGTTGGGGTTG;

• Dpt_F GCAGTTCACCATTGCCGTCGCCTTACTTTG,

• Dpt_R TGAAGATTGAGTGGGTACTGCGGTGGTGGA;

• Drs_F ATCAAGTACTTGTTCGCCCTCTTCGCTGTC,

• Drs_R CTCGTTGTCCCAGACGGCACAGGGACCCTT;

• TepI_F CTGAAGTCTCAGTCAGCCTGACTGGACCTT,

• TepI_R CGTAATCGCCTTCTGTTAGCTTCGGAATGT;

• IMPPP_F ACCGATGAGGCGGGCAACAC,

• IMPPP_R GGCCACGCTGAATGTAGAAT;

• TotA_F TGCTTTGCACTGCTGCTGATTAGTCCTCTA,

• TotA_R TTTCACTCAAATATTAAAACAATATTAACC;

• Upd3_F GGTCACCTACAAGATACTGC,

• Upd3_R TCGCCTTGCACAGACTCTTA.