Article Figures & Data
Figures
- Figure 1. RNA-seq of the clk-1(qm30) (± nuclear or WT clk-1) mutants.
(A) Graphical illustration of clk-1(qm30), clk-1(qm30)+nuc, and clk-1(qm30)+WT lines used for RNA-seq. mRNA was isolated from three biological replicates of each mutant, harvested at the L4 stage. (B) PCA of RNA libraries showing clear distinction between clk-1(qm30), clk-1(qm30)+nuc, and clk-1(qm30)+WT (N = 3 biological replicates for each strain). (C) Correlation matrix of RNA-seq samples shows the expected clustering of the biological triplicates of each strain. (D) Top 50 down-regulated GO terms (left graph) and up-regulated GO terms (right graph) in clk-1(qm30) versus clk-1(qm30)+WT (left column) and clk-1(qm30)+nuc versus clk-1(qm30)+WT (right column). Proportions of GO terms associated with translation and mRNA processing are depicted in yellow, development and reproduction in red, metabolism in green, and ion transport in blue.
- Figure 2. Differentially expressed genes in clk-1(qm30)+nuc compared with clk-1(qm30).
(A) Fold changes of differentially expressed genes in clk-1(qm30) versus clk-1(qm30)+WT plotted against fold changes of clk-1(qm30)+nuc versus clk-1(qm30)+WT shows a minor role for nuclear clk-1 in transcriptional changes. Colors of the individual data points correspond to the colors of the groups of genes in the Venn diagram in (B). (B) Venn diagram shows that most genes are similarly up-regulated (3720) and down-regulated (4397) in the clk-1(qm30)+nuc and clk-1(qm30) worms when comparing with clk-1+WT. There were 292 genes exclusively up-regulated in clk-1(qm30)+nuc (blue) and 704 genes exclusively in clk-1(qm30) (green) compared with clk-1+WT. Furthermore, 175 genes were down-regulated exclusively in clk-1(qm30)+nuc (red) and 805 genes down-regulated exclusively in clk-1(qm30) (orange) compared with clk-1+WT. Differential expressions in (A) and (B) are with a threshold-adjusted P value < 0.01. (C) Significant Cluster GO Enrichments (threshold Enrichment Score > 3) associated with the 704 genes specifically up-regulated (green) and 805 down-regulated (orange) in clk-1(qm30) strain. There were no significant Cluster GO Enrichments for genes exclusively up or down-regulated in clk-1(qm30)+nuc.
- Figure 3. Repressed polysome profiles in the clk-1(qm30) (±nuc) mutants.
(A) Representative traces of polysome profiles of clk-1(qm30) strains harvested at the L4 stage, when lysate is normalized to total protein levels of 500 μg. The monosomal peak and polysomal peaks (P1–P6) are indicated. (B) Quantification of polysome peak sizes (AUC). The fold change is represented compared with P1 of the clk-1(qm30)+WT. All peaks of clk-1(qm30)+WT are significantly different from both clk-1(qm30)+nuc and clk-1(qm30). No peaks were significantly different between clk-1(qm30) and clk-1(qm30)+nuc. Error bars represent mean ± SD. Significance was tested with t test and P-values were adjusted to correct for multiple testing using the Holm–Sidak method, with α = 0.05.
- Figure S1. qPCR analysis of encoding initiation factors and RPs.
Relative expression levels determined by qRT–PCR (WT versus clk-1(qm30)) normalized by expression of pmp-3 as reference gene. Significance was tested with t test and P-values were adjusted to correct for multiple testing using the Holm–Sidak method, with α = 0.05.
- Figure 4. Analysis of total and polysomal RNA clk-1(qm30) and clk-1(qm30)+WT.
(A) Schematic representation of polysomal fraction (blue) used for RNA isolation and total RNA (green) from C. elegans mutants clk-1(qm30) and clk-1(qm30)+WT that were used for RNAseq. (B) Fold changes of differentially expressed genes in the total RNA of clk-1(qm30) versus clk-1(qm30)+WT plotted against fold changes in polysomal RNA of clk-1(qm30) versus clk-1(qm30)+WT. Colors of the individual data points correspond to the colors of the groups of genes in the Venn diagram in (C). (C) Venn diagram showing 1657 genes were similarly up-regulated and 2574 genes down-regulated in both the polysomal as the total RNA in the clk-1(qm30) strain compared with clk-1(qm30)+WT. A total of 434 genes were exclusively up-regulated in the polysomal RNA (blue), whereas 2767 genes were exclusively up-regulated in the total RNA (green). Furthermore, 477 genes were exclusively down-regulated in the polysomal RNA (red) and 2628 genes were exclusively down-regulated in the total RNA. Differential expressions (B, C) are with a threshold-adjusted P value < 0.01. (D) Significant Cluster GO Enrichments (threshold Enrichment Score > 3) associated with the genes specifically up and down-regulated in groups of genes in (C) (colors of the bars correspond again to the color of the groups in (C)). (E) Fib-1 is reduced in both the total and polysomal RNA of clk-1(qm30) compared with clk-1(qm30)+WT. (F, G) FIB-1 levels are reduced in clk-1(qm30) worms compared with N2 worms. Error bars represent mean ± SD, significance was tested with t test, ***P < 0.0005.
- Figure S2. Global analysis of polysomal and total RNA-seq.
(A) Correlation matrix of RNA-seq samples shows the expected clustering of total and polysomal RNA of the biological triplicates of each strain. (B) PCA of RNA libraries showing clear distinction between polysomal and total RNA of each of the strains (N = 3 biological replicates for each strain).
- Figure 5. Translation efficiency (TE) of transcripts in clk-1(qm30) worms.
(A) Volcano plot of log2 fold change of TE (total RNA:polysomal RNA) of transcripts clk-1(qm30):clk-1(qm30)+WT. The blue data points represent transcripts with high TE in clk-1(qm30) worms being shifted from the total RNA to the highly translated polysomal RNA. The red data points represent transcripts that have low TE in clk-1(qm30) being shifted from polysomal RNA to the total RNA. Differentially translationally regulated genes in red and blue with threshold-adjusted P value < 0.01. (B) Significant Cluster GO Enrichments (threshold Enrichment Score > 3) associated with significantly different TEs (colors of the bars correspond again to the data points in (A)). (C) TE of individual transcripts involved in TOR pathway in clk-1(qm30)+WT (left bar) clk-1(qm30) (middle bar) and their ratio (right bar). Colors of the ratio bars correspond again to the data points in (A). Clk-1(qm30) worms slow reduced TE of let-363, daf-15, clk-2, and R10H10.7 and an increased TE for lgg-1. (D) Schematic overview of transcripts involved in TOR pathway that have altered TE in clk-1(qm30) versus clk-1(qm30)+WT represented in (C) and their involvement in longevity.
- Figure 6. RNAi of taf-4 partially restores repressed peaks in clk-1(qm30) mutants.
(A) Representative traces of polysome profiles of clk-1(qm30) worms fed HT115 bacteria transformed with the empty vector (EV) or expressing taf-4 RNAi when harvested at the L4 stage, when lysate is normalized to total protein levels of 500 μg. The monosomal peak and polysomal peaks (P1–P5) are indicated. (B) Representative traces of polysome profiles of clk-1(qm30)+WT worms fed HT115 bacteria transformed with the EV or expressing taf-4 RNAi, when lysate is normalized to total protein levels of 500 μg. The monosomal peak and polysomal peaks are indicated. (C) Quantification of polysome peak sizes (AUC). The fold change is represented compared with P1 of the clk-1(qm30)+WT fed with HT115 bacteria. Polysomal peaks P1 and P2 were significantly different between clk-1(qm30)+WT fed with HT115 and taf-4 RNAi bacteria. No peaks were significantly different between clk-1(qm30)+WT fed with HT115 and taf-4 RNAi bacteria. Error bars represent mean ± SD. Significance was tested with t test and P-values were adjusted to correct for multiple testing using the Holm–Sidak method, with α = 0.05. (D) Relative expression levels determined by qRT–PCR in clk-1(qm30)(+WT) fed with either the EV or taf-4 RNAi bacteria. Expression levels were normalized using the geometrical mean of reference genes Y45F10D.4, tba-1, and csq-1. Significance was tested using one-way ANOVA with Sidak's multiple comparisons test. Error bars represent mean ± SEM. **P < 0.01, significance indicated only between clk-1(qm30) EV and clk-1(qm30) taf-4 RNAi.
Tables
- Table 1.
Identified polysomal transcripts involved in OXPHOS that, compared with clk-1(qm30)+WT, are enriched in clk-1(qm30).
Accession Gene name Description log2 fold change polysomal RNA Complex I C16A3.5 C16A3.5 Orthologue B9 subunit of the mitochondrial complex I 0.42 C18E9.4 C18E9.4 Orthologue B12 subunit of the mitochondrial complex I 0.61 C25H3.9 C25H3.9 Orthologue B5 subunit of the mitochondrial complex I 0.40 C33A12.1 C33A12.1 Orthologue A5/B13 subunit of the mitochondrial complex I 0.43 C34B2.8 C34B2.8 Orthologue A13 subunit of the mitochondrial complex I 0.48 F37C12.3 F37C12.3 Orthologue AB1 subunit of the mitochondrial complex I 0.53 F42G8.10 F42G8.10 Orthologue B11 subunit of the mitochondrial complex I 0.38 F44G4.2 F44G4.2 Orthologue B2 subunit of the mitochondrial complex I 0.54 F53F4.10 F53F4.10 Orthologue NADH-UQ oxidoreductase flavoprotein 2 0.45 ZK973.10 lpd-5 NADH-UQ oxidoreductase fe-s protein 4 0.37 W10D5.2 nduf-7 NADH-UQ oxidoreductase fe-s protein 7 0.47 C09H10.3 nuo-1 NADH UQ oxidoreductase 1 0.35 T10E9.7 nuo-2 NADH UQ oxidoreductase 2 0.47 W01A8.4 nuo-6 NADH UQ oxidoreductase 6 0.47 T20H4.5 T20H4.5 Orthologue NADH-UQ oxidoreductase Fe-S protein 8 0.39 Y53G8AL.2 Y53G8AL.2 Orthologue A9 subunit of the mitochondrial complex I 0.48 Complex II F42A8.2 sdhb-1 Succinate dehydrogenase complex subunit B 0.37 F33A8.5 sdhd-1 Succinate dehydrogenase complex subunit D 0.74 Complex III C54G4.8 cyc-1 Cytochrome C reductase 0.35 F42G8.12 isp-1 Rieske iron sulphur protein subunit of the mitochondrial complex III 0.27 R07E4.3 R07E4.3 Orthologue subunit VII ubiquinol–cytochrome c reductase complex III 0.54 T02H6.11 T02H6.11 Ubiquinol–cytochrome c reductase binding protein 0.40 T27E9.2 T27E9.2 Ubiquinol–cytochrome c reductase hinge protein 0.54 F57B10.14 ucr-11 Ubiquinol–cytochrome c oxidoreductase complex 0.75 Complex IV F26E4.9 cco-1 Cytochrome C oxidase 0.46 Y37D8A.14 cco-2 Cytochrome C oxidase 0.46 F26E4.6 F26E4.6 Orthologue cytochrome c oxidase subunit 7C 0.55 F29C4.2 F29C4.2 Orthologue cytochrome c oxidase subunit 6C 0.66 F54D8.2 tag-174 Orthologue cytochrome c oxidase subunit 6A2 0.45 Y71H2AM.5 Y71H2AM.5 Orthologue cytochrome c oxidase subunit 6B1 0.48 Complex V C53B7.4 asg-2 ATP synthase G homolog 0.79 C06H2.1 atp-5 ATP synthase subunit 0.45 F32D1.2 hpo-18 Orthologue of ATP synthase, H+ transporting, mitochondrial F1 complex, ε subunit 0.56 R04F11.2 R04F11.2 Orthologue of ATP synthase, H+ transporting, mitochondrial Fo complex, ε subunit 0.51 R53.4 R53.4 Mitochondrial ATP synthase subunit f homolog 0.34 R10E11.8 vha-1 Vacuolar H ATPase 1 0.50 R10E11.2 vha-2 Vacuolar H ATPase 2 0.63 Y38F2AL.4 vha-3 Vacuolar H ATPase 3 0.58 T01H3.1 vha-4 Vacuolar H ATPase 4 0.61 VW02B12L.1 vha-6 Vacuolar H ATPase 6 0.59 C17H12.14 vha-8 Vacuolar H ATPase 8 0.66 ZK970.4 vha-9 Vacuolar H ATPase 9 0.43 F46F11.5 vha-10 Vacuolar H ATPase 10 0.64 Y38F2AL.3 vha-11 Vacuolar H ATPase 11 0.58 F20B6.2 vha-12 Vacuolar H ATPase 12 0.34 Y49A3A.2 vha-13 Vacuolar H ATPase 13 0.35 F55H2.2 vha-14 Vacuolar H ATPase 14 0.49 T14F9.1 vha-15 Vacuolar H ATPase 15 0.51 C30F8.2 vha-16 Vacuolar H ATPase 16 0.55 Y69A2AR.18 Y69A2AR.18 Orthologue of ATP synthase, H+ transporting, mitochondrial F1 complex, γ subunit 0.25 - Table 2.
Identified polysomal transcripts involved in mRNA translation that, compared with clk-1(qm30)+WT, are reduced in clk-1(qm30).
Accession Gene name Description log2 fold change Translation ZC434.5 ears-1 Glutamyl(E) amino-acyl tRNA synthetase −0.51 F31E3.5 eef-1A.1 Eukaryotic translation elongation factor 1-α −0.67 F25H5.4 eef-2 Eukaryotic translation elongation factor 2 −0.53 C27D11.1 egl-45 Eukaryotic translation initiation factor 3 subunit A −0.50 F11A3.2 eif-2Bdelta Eukaryotic translation initiation factor 2B subunit Δ −0.79 Y54E2A.11 eif-3.B Eukaryotic translation initiation factor 3 subunit B −0.38 T23D8.4 eif-3.C Eukaryotic translation initiation factor 3 subunit C −0.43 R11A8.6 iars-1 Isoleucyl(I) amino-acyl tRNA synthetase −0.26 M110.4 ifg-1 Initiation factor 4G (eIF4G) family −0.43 K10C3.5 K10C3.5 Orthologue of Ria1p −0.92 R74.1 lars-1 Leucyl(L) amino-acyl tRNA synthetase −0.36 C47E12.1 sars-1 Seryl(S) amino-acyl tRNA synthetase −0.43 F28H1.3 aars-2 Alanyl(A) amino-acyl tRNA synthetase −0.46 K08F11.3 cif-1 COP9/signalosome and eIF3 complex shared subunit −0.37 Y41E3.10 eef-1B.2 Eukaryotic translation elongation factor −0.31 Y37E3.10 eif-2A Eukaryotic initiation factor −1.06 R08D7.3 eif-3.D Eukaryotic initiation factor −1.61 Y40B1B.5 eif-3.J Eukaryotic initiation factor −1.24 C17G10.9 eif-3.L Eukaryotic initiation factor −0.61 C47B2.5 eif-6 Eukaryotic initiation factor −0.53 T05H4.6 erfa-1 Eukaryotic release factor homolog −0.30 F22B5.9 fars-3 Phenylalanyl(F) amino-acyl tRNA synthetase −1.65 T10F2.1 gars-1 Glycyl(G) amino-acyl tRNA synthetase −0.41 F53A2.6 ife-1 Initiation factor 4E (eIF4E) family −0.72 B0348.6 ife-3 Initiation factor 4E (eIF4E) family −0.55 T05G5.10 iff-1 Initiation factor five (eIF-5A) homolog −0.31 Y54F10BM.2 iffb-1 Initiation factor five B (eIF5B) −0.75 F57B9.6 inf-1 Initiation factor −0.31 T02G5.9 kars-1 Lysyl(K) amino-acyl tRNA synthetase −0.30 F58B3.5 mars-1 Methionyl(M) amino-acyl tRNA synthetase −0.62 F22D6.3 nars-1 Asparaginyl(N) amino-acyl tRNA synthetase −0.64 Y41E3.4 qars-1 Glutaminyl(Q) amino-acyl tRNA synthetase −0.43 F26F4.10 rars-1 Arginyl(R) amino-acyl tRNA synthetase −0.55 C47D12.6 tars-1 Threonyl(T) amino-acyl tRNA synthetase −0.44 Y87G2A.5 vrs-2 Valyl(V) amino-acyl tRNA synthetase −0.41 Y80D3A.1 wars-1 Tryptophanyl(W) amino-acyl tRNA synthetase −0.67 Y105E8A.19 yars-1 Tyrosinyl(Y) amino-acyl tRNA synthetase −0.90 Ribosome Y71F9AL.13 rpl-1 Large ribosomal subunit L1 protein −0.53 B0250.1 rpl-2 Large ribosomal subunit L2 protein −0.82 F13B10.2 rpl-3 Large ribosomal subunit L3 protein −0.75 B0041.4 rpl-4 Large ribosomal subunit L4 protein −0.95 54C9.5 rpl-5 Large ribosomal subunit L5 protein −0.58 R151.3 rpl-6 Large ribosomal subunit L6 protein −0.37 Y24D9A.4 rpl-7A Large ribosomal subunit L7A protein −0.44 R13A5.8 rpl-9 Large ribosomal subunit L9 protein −0.67 JC8.3 rpl-12 Large ribosomal subunit L12 protein −0.48 C32E8.2 rpl-13 Large ribosomal subunit L13 protein −0.56 C04F12.4 rpl-14 Large ribosomal subunit L14 protein −0.30 K11H12.2 rpl-15 Large ribosomal subunit L15 protein −0.61 M01F1.2 rpl-16 Large ribosomal subunit L16 protein −0.73 Y48G8AL.8 rpl-17 Large ribosomal subunit L17 protein −0.45 Y45F10D.12 rpl-18 Large ribosomal subunit L18 protein −0.66 C09D4.5 rpl-19 Large ribosomal subunit L18A protein −0.51 E04A4.8 rpl-20 Large ribosomal subunit L20 protein −0.69 C14B9.7 rpl-21 Large ribosomal subunit L18A protein −0.51 D1007.12 rpl-24.1 Large ribosomal subunit L20 protein −0.51 F28C6.7 rpl-26 Large ribosomal subunit L18A protein −0.29 T24B8.1 rpl-32 Large ribosomal subunit L20 protein −0.26 F37C12.4 rpl-36 Large ribosomal subunit L18A protein −0.39 C26F1.9 rpl-39 Large ribosomal subunit L20 protein −0.98 C09H10.2 rpl-41 Large ribosomal subunit L18A protein −0.41 Y48B6A.2 rpl-43 Large ribosomal subunit L20 protein −0.50 B0393.1 rps-0 Small ribosomal subunit S protein −0.49 F56F3.5 rps-1 Small ribosomal subunit S1 protein −0.57 C49H3.11 rps-2 Small ribosomal subunit S2 protein −0.50 C23G10.3 rps-3 Small ribosomal subunit S3 protein −0.50 Y43B11AR.4 rps-4 Small ribosomal subunit S4 protein −0.54 T05E11.1 rps-5 Small ribosomal subunit S5 protein −0.45 Y71A12B.1 rps-6 Small ribosomal subunit S6 protein −0.83 ZC434.2 rps-7 Small ribosomal subunit S7 protein −0.39 F40F11.1 rps-11 Small ribosomal subunit S11 protein −0.57 F37C12.9 rps-14 Small ribosomal subunit S14 protein −0.51 T08B2.10 rps-17 Small ribosomal subunit S17 protein −0.41 Y57G11C.16 rps-18 Small ribosomal subunit S18 protein −0.48 F37C12.11 rps-21 Small ribosomal subunit S21 protein −0.35 F53A3.3 rps-22 Small ribosomal subunit S22 protein −0.44 T07A9.11 rps-24 Small ribosomal subunit S24 protein −0.53 H06I04.4 ubl-1 Small ribosomal subunit S27a protein −0.37 Y62E10A.1 rla-2 Ribosomal protein, large subunit, acidic (P1) −0.39 F10B5.1 rpl-10 Large ribosomal subunit L10 protein −0.42 T22F3.4 rpl-11.1 Large ribosomal subunit L11 protein −1.26 C27A2.2 rpl-22 Large ribosomal subunit L22 protein −0.47 C03D6.8 rpl-24.2 Large ribosomal subunit L24 protein −0.68 F52B5.6 rpl-25.2 Large ribosomal subunit L23a protein −0.82 C53H9.1 rpl-27 Large ribosomal subunit L27 protein −0.52 R11D1.8 rpl-28 Large ribosomal subunit L28 protein −0.65 C42C1.14 rpl-34 Large ribosomal subunit L34 protein −0.53 ZK1010.1 rpl-40 Large ribosomal subunit L40 protein −0.52 C16A3.9 rps-13 Small ribosomal subunit S13 protein −0.57 F36A2.6 rps-15 Small ribosomal subunit S15 protein −0.49 T05F1.3 rps-19 Small ribosomal subunit S19 protein −0.44 Y105E8A.16 rps-20 Small ribosomal subunit S20 protein −0.47 F28D1.7 rps-23 Small ribosomal subunit S23 protein −0.62 Y41D4B.5 rps-28 Small ribosomal subunit S28 protein −0.64 C26F1.4 rps-30 Small ribosomal subunit S30 protein and ubiquitin −0.43 F42C5.8 rps-8 Small ribosomal subunit S8 protein −0.70 F40F8.10 rps-9 Small ribosomal subunit S9 protein −0.41 W01D2.1 W01D2.1 Orthologue of human RPL37 (ribosomal protein L37) −0.41 Y37E3.8 Y37E3.8 Orthologue of human RPL27A (ribosomal protein L27a) −0.40 mRNA processing W03H9.4 cacn-1 CACtiN (Drosophila cactus interacting protein) homolog −0.65 F32B6.3 F32B6.3 Pre-mRNA processing factor 18 −0.85 K07C5.6 K07C5.6 Homologue of splicing factor SLU7 −0.95 F33A8.1 let-858 Similarity to eukaryotic initiation factor eIF-4 γ −0.47 C04H5.6 mog-4 DEAH helicase −0.65 EEED8.5 mog-5 DEAH box helicase 8 −0.52 C50C3.6 prp-8 Yeast PRP (splicing factor) related −0.27 Y46G5A.4 snrp-200 Small nuclear ribonucleoprotein homologue −0.38 C07E3.1 stip-1 Septin- and tuftelin-interacting protein homologue −0.84 W04D2.6 W04D2.6 Orthologue of human RBM25 −0.57 Highlighted in grey are the transcripts that were up-regulated in both the polysomal RNA as the total pool of RNA.
Gene Gene ID Forward primer Reverse primer Y45F10D.4 178344 GTCGCTTCAAATCAGTTCAGC GTTCTTGTCAAGTGATCCGACA tba-1 172831 AGACCAACAAGCCGATGGAG TCCAGTGCGGATCTCATCAAC csq-1 181563 GTGACATCTAAATGGGCACGC CTCACGGGTTTCCTCGTCAA eif-1 266853 TCAGCGTGACAAGGTCAAGG GTGCACTCTGCAGTTGGACT eif-3.C 172858 GGAGGACAAGGACAAGACGG AGAAGGCTCGTGGCTTTTGA inf-1 175966 GGAAGGTCGACACACTCACC ATGTCTCCGTGGAGGCAAGA rpl-11.1 178778 GGTTTCGGAGTTCAGGAGCA TTGCGGTTCAGAACGACGTA rpl-14 172818 CAAGCTCACCGACTTCGAGA GAGCTCCACTCGGACGATTC
In this Issue
Subjects
Related Articles
Cited By...
- No citing articles found.