Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms
ReviewThe RNAs of RNA-directed DNA methylation☆
Section snippets
Overview of RNA-directed DNA methylation (RdDM) and multisubunit RNA Polymerases IV and V
RNA-directed chromatin modification is used throughout eukaryotes as a means to prevent the transcription and movement of transposable elements, thereby protecting the genome from mutation and instability. In eukaryotes that do not methylate their DNA, such as fission yeast, fruit flies or nematodes, small noncoding RNAs (RNAs that do not encode proteins) can guide histone modifications that help establish chromatin states refractive to transcription by RNA polymerases I, II or III. These same
Pol IV transcript function: precursors for siRNAs
The requirement of Pol IV for the accumulation of 24 nt siRNAs in vivo was one of the first phenotypes identified in the initial characterization of this enzyme [35], [73]. However, the Pol IV-dependent precursors that give rise to siRNAs have only been described recently, based on their accumulation when DICER-LIKE 3 (DCL3), the endonuclease primarily responsible for 24 nt siRNA processing, is mutated [8], [60], [98], [99], [101]. Mutations in DCL2 and DCL4 further increase the abundance of
How do Pols IV and V know where to transcribe?
Given the importance of Pols IV and V in RNA-directed DNA methylation and gene silencing, a critical question is: how do these polymerases target specific loci? DNA sequences associated with Pol IV and Pol V have been identified genome-wide by chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) [56], [92], [109]. No consensus sequences that are highly correlated with Pol IV or Pol V-associated regions have been identified. This suggests that Pol IV and Pol V recruitment may not
P4R2 and Pol V transcript characteristics
Because Pols IV and V are evolutionarily derivatives of Pol II, might their transcripts undergo processing like Pol II derived mRNAs? Major processing steps for Pol II transcripts include the addition of a 7-methylguanosine cap on the 5′ end, a 3′ poly-A tail, and splicing of intronic sequences. All of these modifications are mediated by protein-protein interactions between Pol II and processing enzymes. Of particular importance is the C-terminal domain (CTD) of the Pol II largest subunit,
Outstanding questions for Pol IV and Pol V dependent RNAs
As noted above, Pol IV and RDR2 are both capable of transcription independently of one another in vitro, yet both are equally required for the accumulation of P4R2 RNAs in vivo. Thus, a major question remaining for P4R2 RNAs is the extent to which Pol IV and RDR2 each contribute to the population of precursor RNAs present in vivo. The presence of a 5′ monophosphate on P4R2 RNAs strongly suggests there are additional steps in P4R2 RNA processing that are yet to be discovered. Indeed, a recent
RNA extraction and RT-PCR
Total RNA was extracted from 2–2.5 week old above-ground tissue of Col-0 WT or nrpe1–11 [77] using Trizol and RT-PCR was conducted as described in [93]. Primers for IGN22 (RT: 5′ CGGGTCCTTGGACTCCTGAT 3′; PCR: 5′ TCGTGACCGGAATAATTAAATGG 3′), IGN23 (RT: 5′ GCCATTAGTTTTAGATGGACTGCAA 3′; PCR: 5′ GGGCGAACCTGGAGAAAGTT 3′), IGN25 (RT: 5′ CTTCTTATCGTGTTACATTGAGAACTCTTTCC 3′; PCR: 5′ ATTCGTGTGGGCTTGGCCTCTT 3′), and IGN26 (RT: 5′ CGTGACATTAGAAGCTCTACGAGAA 3′; PCR: 5′ TTCCTGGCCGTTGATTGGT 3′) are from [83].
Acknowledgements
Research in the Pikaard lab is supported by National Institutes of Health grant GM077590 (to C.S.P.) and support to C.S.P. as an Investigator of the Howard Hughes Medical Institute and the Gordon and Betty Moore Foundation. JMW received support from the NIH departmental training Grant, T32GM007757, and the National Institute of General Medical Sciences of the NIH under Award Number F31GM116346. The content of this work is solely the responsibility of the authors and does not necessarily
References (111)
- et al.
Structural basis of transcription initiation by bacterial RNA polymerase holoenzyme
J. Biol. Chem.
(2014) - et al.
A two-step process for epigenetic inheritance in Arabidopsis
Mol. Cell
(2014) - et al.
Role of the DRM and CMT3 methyltransferases in RNA-directed DNA methylation
Curr. Biol.
(2003) - et al.
Role of the Arabidopsis DRM methyltransferases in de novo DNA methylation and gene silencing
Curr. Biol.
(2002) - et al.
Dual binding of chromomethylase domains to H3K9me2-containing nucleosomes directs DNA methylation in plants
Cell
(2012) - et al.
Functional diversification of maize RNA polymerase IV and V subtypes via alternative catalytic subunits
Cell Rep.
(2014) - et al.
In vitro transcription activities of Pol IV, Pol V, and RDR2 reveal coupling of Pol IV and RDR2 for dsRNA synthesis in plant RNA silencing
Mol. Cell
(2012) - et al.
An effector of RNA-directed DNA methylation in Arabidopsis is an ARGONAUTE 4- and RNA-binding protein
Cell
(2009) - et al.
Interplay between two epigenetic marks. DNA methylation and histone H3 lysine 9 methylation
Curr. Biol.
(2002) - et al.
The SRA methyl-cytosine-binding domain links DNA and histone methylation
Curr. Biol.
(2007)
The zinc-finger protein SPT4 interacts with SPT5L/KTF1 and modulates transcriptional silencing in Arabidopsis
FEBS Lett.
A protein complex required for polymerase V transcripts and RNA- directed DNA methylation in Arabidopsis
Curr. Biol.
Methylation protects miRNAs and siRNAs from a 3′-end uridylation activity in Arabidopsis
Curr. Biol.
Involvement of a GHKL ATPase in RNA-directed DNA methylation in Arabidopsis thaliana
Curr. Biol.
Molecular basis of transcription-coupled pre-mRNA capping
Mol. Cell
Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance
Cell
T-coffee: a novel method for fast and accurate multiple sequence alignment
J. Mol. Biol.
Plant nuclear RNA polymerase IV mediates siRNA and DNA methylation-dependent heterochromatin formation
Cell
The evolutionarily conserved Pol II flap loop contributes to proper transcription termination on short yeast genes
Cell Rep.
The Arabidopsis chromatin-modifying nuclear siRNA pathway involves a nucleolar RNA processing center
Cell
NERD, a plant-specific GW protein, defines an additional RNAi-dependent chromatin-based pathway in Arabidopsis
Mol. Cell
Subunit compositions of the RNA-silencing enzymes Pol IV and Pol V reveal their origins as specialized forms of RNA polymerase II
Mol. Cell
A dual interface determines the recognition of RNA polymerase II by RNA capping enzyme
J. Biol. Chem.
A role for small RNAs in DNA double-strand break repair
Cell
Noncoding transcription by RNA polymerase Pol IVb/Pol V mediates transcriptional silencing of overlapping and adjacent genes
Cell
A dicer-independent route for biogenesis of siRNAs that direct DNA methylation in Arabidopsis
Mol. Cell
The Arabidopsis nucleosome remodeler DDM1 allows DNA methyltransferases to access H1-containing heterochromatin
Cell
HDA6, a putative histone deacetylase needed to enhance DNA methylation induced by double-stranded RNA
EMBO J.
INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis
Proc. Natl. Acad. Sci. U. S. A.
IDN1 and IDN2 are required for de novo DNA methylation in Arabidopsis thaliana
Nat. Struct. Mol. Biol.
Triphosphate residues at the 5′ ends of rRNA precursor and 5S RNA from Dictyostelium discoideum
Proc. Natl. Acad. Sci. U. S. A.
Coupling mRNA processing with transcription in time and space
Nat. Rev. Genet.
RNA-directed DNA methylation requires an AGO4-interacting member of the SPT5 elongation factor family
EMBO Rep.
Identification of Pol IV and RDR2-dependent precursors of 24 nt siRNAs guiding de novo DNA methylation in Arabidopsis
Elife
RNA-directed DNA methylation requires stepwise binding of silencing factors to long non-coding RNA
Plant J.
Locus-specific control of asymmetric and CpNpG methylation by the DRM and CMT3 methyltransferase genes
Proc. Natl. Acad. Sci. U. S. A.
Chromosome-specific NOR inactivation explains selective rRNA gene silencing and dosage control in Arabidopsis
Genes Dev.
Structure of eukaryotic RNA polymerases
Annu. Rev. Biophys.
miRNAs trigger widespread epigenetically activated siRNAs from transposons in Arabidopsis
Nature
Involvement of a Jumonji-C domain-containing histone demethylase in DRM2-mediated maintenance of DNA methylation
EMBO Rep.
Specific but interdependent functions for Arabidopsis AGO4 and AGO6 in RNA-directed DNA methylation
EMBO J.
Mechanisms of HDA6-mediated rRNA gene silencing: suppression of intergenic Pol II transcription and differential effects on maintenance versus siRNA-directed cytosine methylation
Genes Dev.
H3 lysine 9 methylation is maintained on a transcribed inverted repeat by combined action of SUVH6 and SUVH4 methyltransferases
Mol. Cell. Biol.
Locus-specific control of DNA methylation by the Arabidopsis SUVH5 histone methyltransferase
Plant Cell
Reiterated WG/GW motifs form functionally and evolutionarily conserved ARGONAUTE-binding platforms in RNAi-related components
Genes Dev.
Arabidopsis RNASE THREE LIKE2 modulates the expression of protein-coding genes via 24-nucleotide small interfering RNA-directed DNA methylation
Plant Cell
AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana
PLoS One
Isolation and identification by sequence homology of a putative cytosine methyltransferase from Arabidopsis thaliana
Nucleic Acids Res.
An RNA polymerase II- and AGO4-associated protein acts in RNA-directed DNA methylation
Nature
Multisubunit RNA polymerases IV and V: purveyors of non-coding RNA for plant gene silencing
Nat. Rev. Mol. Cell Biol.
Cited by (104)
Viroid infection and host epigenetic alterations
2023, Fundamentals of Viroid BiologySmall RNAs as emerging regulators of agricultural traits of food crops
2023, Plant Small RNA in Food CropsEpigenetic marks for mitigating abiotic stresses in plants
2022, Journal of Plant PhysiologySeeking the truth behind the myth: Argonaute tales from “nuclearland”
2022, Molecular CellDeciphering comparative and structural variation that regulates abiotic stress response
2022, Bioinformatics in Agriculture: Next Generation Sequencing EraThe structure, function, and evolution of plant centromeres
2024, Genome Research
- ☆
This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.