Table 2.

Some novel miRNAs have orthologous sequences in human and/or mouse genomes.

Novel rat miRNAsMouse orthologsHuman orthologs
NameSequenceNameSequenceNameSequence
rno-novel-miR-7-5pAGUCAGGCUACUGGUUAUAUUCCAmmu-miR-344-5pAGUCAGGCUCCUGGCUAGAUUCCAGGN/AN/A
rno-novel-miR-8-3pGGUAUAACCAAAGCCCGACUGAmmu-miR-344h-3pGGUAUAACCAAAGCCCGACUGUN/AN/A
rno-novel-miR-14-3pUCUCUGGGCCUGUGUCUUmmu-miR-330-5pUCUCUGGGCCUGUGUCUUAGGChsa-miR-330-5pUCUCUGGGCCUGUGUCUUAGGC
rno-novel-miR-24-5pUCAAGAGCAAUAACGAAAAmmu-miR-335-5pUCAAGAGCAAUAACGAAAAAUGUhsa-miR-335-5pUCAAGAGCAAUAACGAAAAAUGU
rno-novel-miR-35-5pUUUCCUCUCUGCCCCAUAGGGUmmu-miR-3059-5pUUUCCUCUCUGCCCCAUAGGGUN/AN/A
rno-novel-miR-37-3pGCAGGAACUUGUGAGUCUmmu-miR-873a-5pGCAGGAACUUGUGAGUCUCCUhsa-miR-873-5pGCAGGAACUUGUGAGUCUCCU
rno-novel-miR-38-5pACUCUAGCUGCCAAAGGCGCUmmu-miR-1251-5pACUCUAGCUGCCAAAGGCGCUhsa-miR-1251-5pACUCUAGCUGCCAAAGGCGCU
rno-novel-miR-56-5pACUGGACUUGGAGUCAGAAGmmu-miR-378cACUGGACUUGGAGUCAGAAGChsa-miR-378a-3pACUGGACUUGGAGUCAGAAGGC
rno-novel-miR-64-5pCUAAGGCAGGCAGACUUCAGUGUmmu-miR-6540-5pCUAAGGCAGGCAGACUUCAGUGN/AN/A
rno-novel-miR-72-3pCCAGUAUUGACUGUGCUGCUGAAmmu-miR-16-1-3pCCAGUAUUGACUGUGCUGCUGAhsa-miR-16-1-3pCCAGUAUUAACUGUGCUGCUGA
rno-novel-miR-87-5pGUUCCUGCUGAACUGAGCCAGUmmu-miR-3074-5pGUUCCUGCUGAACUGAGCCAGUhsa-miR-3074-5pGUUCCUGCUGAACUGAGCCAG
rno-novel-miR-90-5pAGGUCCUCAGUAAGUAUUUGUUmmu-miR-1264-5pAGGUCCUCAGUAAGUAUUUGUUN/AN/A
  • Novel-miRNAs with their corresponding orthologous sequences in the mouse and/or human. We defined as ortholog an miRNA sequence with a minimum of 95% similarities with an miRNA from another species.