Table 3.

Novel miRNAs with their corresponding functional orthologous sequences in the mouse and/or human.

NameSequenceNameSequenceNameSequence
rno-novel-miR-78-5pUGCCCCUGCUGAGGCUGUGUCUmmu-miR-3070-5pAGCCCCUGACCUUGAACCUGGGAAGCCCCUGACCUUGAACCUGGGAN/AN/A
rno-novel-miR-79-3pUUAGGACUCUGGUCAUCUUUGGN/AN/Ahsa-miR-3117-3pAUAGGACUCAUAUAGUGCCAGAUAGGACUCAUAUAGUGCCAG
rno-novel-miR-60-5pCAGGGAGAGAACUAGUACAGN/AN/Ahsa-miR-6760-5pCAGGGAGAAGGUGGAAGUGCAGACAGGGAGAAGGUGGAAGUGCAGA
rno-novel-miR-86-3pACAGACUGGUGCCUGGGUGUGGN/AN/Ahsa-miR-4494CCAGACUGUGGCUGACCAGAGGCCAGACUGUGGCUGACCAGAGG
rno-novel-miR-63-5pGCCUGAGAGCUGGGGGUAN/AN/Ahsa-miR-4324CCCUGAGACCCUAACCUUAACCCUGAGACCCUAACCUUAA
rno-novel-miR-21-5pCCGUCCUGUACUGCAGCAmmu-miR-676-3pCCGUCCUGAGGUUGUUGAGCUCCGUCCUGAGGUUGUUGAGCUhsa-miR-676-3pCCGUCCUGAGGUUGUUGAGCUCCGUCCUGAGGUUGUUGAGCU
rno-novel-miR-54-3pUGUGUCUUUCUCCCUCUUGACN/AN/Ahsa-miR-4711-3pCGUGUCUUCUGGCUUGAUCGUGUCUUCUGGCUUGAU
rno-novel-miR-57-3pCUCUCACCUCCCGCUCUCCACAN/AN/Ahsa-miR-1229-3pCUCUCACCACUGCCCUCCCACAGCUCUCACCACUGCCCUCCCACAG
rno-novel-miR-48-5pAUGGCGGCUGUGAGUCUGN/AN/Ahsa-miR-6770-3pCUGGCGGCUGUGUCUUCACAGCUGGCGGCUGUGUCUUCACAG
rno-novel-miR-84-5pCUGUGGGCUGCAGGAGGACmmu-miR-134-3pCUGUGGGCCACCUAGUCACCCUGUGGGCCACCUAGUCACChsa-miR-134-3pCUGUGGGCCACCUAGUCACCCUGUGGGCCACCUAGUCACC
rno-novel-miR-80-3pCCCAGGGAGCUGUAAGAGCCGmmu-miR-7226-5pGCCAGGGAAGUUGAUUGUGUGAAGGGGCCAGGGAAGUUGAUUGUGUGAAGGGN/AN/A
rno-novel-miR-59-3pUCCCCUGGGUCUGUGCUCUGCAmmu-miR-331-3pGCCCCUGGGCCUAUCCUAGAAGCCCCUGGGCCUAUCCUAGAAhsa-miR-331-3pGCCCCUGGGCCUAUCCUAGAAGCCCCUGGGCCUAUCCUAGAA
rno-novel-miR-25-3pGCGGGCGGGCGGGAGGCGmmu-miR-5126GCGGGCGGGGCCGGGGGCGGGGGCGGGCGGGGCCGGGGGCGGGGN/AN/A
rno-novel-miR-3-3pAUAAGUGUAGAGAGUCUGUAGUmmu-miR-668-5pGUAAGUGUGCCUCGGGUGAGCAUGGUAAGUGUGCCUCGGGUGAGCAUGN/AN/A
rno-novel-miR-71-5pCUCCCUCUAGUCCUCUUGGUUGUN/AN/Ahsa-miR-642a-5pGUCCCUCUCCAAAUGUGUCUUGGUCCCUCUCCAAAUGUGUCUUG
rno-novel-miR-9-3pCUGGGCGGGAUGGGAGGUGGN/AN/Ahsa-miR-1228-5pGUGGGCGGGGGCAGGUGUGUG
rno-novel-miR-17-5pGCAAGGCCCAGCGAGUGACUN/AN/Ahsa-miR-3922-5pUCAAGGCCAGAGGUCCCACAGCA
rno-novel-miR-41-5pUCCGGGGCUGCGGGAUGAmmu-miR-673-3pUCCGGGGCUGAGUUCUGUGCACCN/AN/A
rno-novel-miR-32-5pACUCGGAUCAAGCUGAGAGCCAmmu-miR-6336UCUCGGAUUUAGUAAGAGAUCN/AN/A
rno-novel-miR-49-5pACUCUCUCACUCUGCAUGGUUAN/AN/Ahsa-miR-7110-3pUCUCUCUCCCACUUCCCUGCAG
rno-novel-miR-73-3pUGGAGGAGAGAAAAAGAGAN/AN/Ahsa-miR-765UGGAGGAGAAGGAAGGUGAUG
rno-novel-miR-77-5pAGUUUUCUGCCUUUCGCUCUGUGGmmu-miR-7214-5pUGUUUUCUGGGUUGGAAUGAGAAN/AN/A
rno-novel-miR-10-3pAUUCUUCUCAGUGGGCUUAGAmmu-miR-6946-3pUUUCUUCUCUUCCCUUUCAGN/AN/A
  • Functional orthologous sequences were determined with a perfect homology into the seed region (italicized sequence).